FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625531_at:

>probe:Drosophila_2:1625531_at:503:249; Interrogation_Position=152; Antisense; CAAGTGCAGGCAGTGGCTCCATCCA
>probe:Drosophila_2:1625531_at:463:469; Interrogation_Position=191; Antisense; GTTCCAGTGGCCGTTAAGTGCTATA
>probe:Drosophila_2:1625531_at:58:279; Interrogation_Position=211; Antisense; CTATAGCCGGTGTCTGATCCAGGAT
>probe:Drosophila_2:1625531_at:469:545; Interrogation_Position=284; Antisense; GGATCTCAAGAGGACCACGTGATTT
>probe:Drosophila_2:1625531_at:430:461; Interrogation_Position=304; Antisense; GATTTTGTCCCAGTGTAAGCAGCAG
>probe:Drosophila_2:1625531_at:14:659; Interrogation_Position=319; Antisense; TAAGCAGCAGTTCGATGGCGTCACC
>probe:Drosophila_2:1625531_at:105:441; Interrogation_Position=332; Antisense; GATGGCGTCACCAATCTGGACACGT
>probe:Drosophila_2:1625531_at:314:41; Interrogation_Position=345; Antisense; ATCTGGACACGTGCGACTATCCATA
>probe:Drosophila_2:1625531_at:520:683; Interrogation_Position=362; Antisense; TATCCATACCTGATTCTCCAGTGTT
>probe:Drosophila_2:1625531_at:306:555; Interrogation_Position=407; Antisense; GGAACTATCGCCTCGTAATTTACCA
>probe:Drosophila_2:1625531_at:25:399; Interrogation_Position=497; Antisense; GACACAATGGGCTTCATCACAGTTC
>probe:Drosophila_2:1625531_at:32:259; Interrogation_Position=514; Antisense; CACAGTTCATTGTTGAGTCTTCTAA
>probe:Drosophila_2:1625531_at:205:239; Interrogation_Position=537; Antisense; AATCAGATCAAACGCCCTCTAATGG
>probe:Drosophila_2:1625531_at:584:193; Interrogation_Position=669; Antisense; AACTCGTCTGCTTTTTATTGATTTG

Paste this into a BLAST search page for me
CAAGTGCAGGCAGTGGCTCCATCCAGTTCCAGTGGCCGTTAAGTGCTATACTATAGCCGGTGTCTGATCCAGGATGGATCTCAAGAGGACCACGTGATTTGATTTTGTCCCAGTGTAAGCAGCAGTAAGCAGCAGTTCGATGGCGTCACCGATGGCGTCACCAATCTGGACACGTATCTGGACACGTGCGACTATCCATATATCCATACCTGATTCTCCAGTGTTGGAACTATCGCCTCGTAATTTACCAGACACAATGGGCTTCATCACAGTTCCACAGTTCATTGTTGAGTCTTCTAAAATCAGATCAAACGCCCTCTAATGGAACTCGTCTGCTTTTTATTGATTTG

Full Affymetrix probeset data:

Annotations for 1625531_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720