Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625532_at:

>probe:Drosophila_2:1625532_at:26:503; Interrogation_Position=1365; Antisense; GTCCGTTCGATGGACCCGTGAACAA
>probe:Drosophila_2:1625532_at:39:439; Interrogation_Position=1373; Antisense; GATGGACCCGTGAACAACAACTACT
>probe:Drosophila_2:1625532_at:669:253; Interrogation_Position=1387; Antisense; CAACAACTACTGAGCGCGGTGCGAT
>probe:Drosophila_2:1625532_at:189:331; Interrogation_Position=1402; Antisense; GCGGTGCGATCAGGATGCCATTCAA
>probe:Drosophila_2:1625532_at:338:107; Interrogation_Position=1450; Antisense; AGAAGCCCACATCTAACAAATTTAG
>probe:Drosophila_2:1625532_at:183:699; Interrogation_Position=1470; Antisense; TTTAGCTACTCAATTCAGTGACATT
>probe:Drosophila_2:1625532_at:690:669; Interrogation_Position=1554; Antisense; TTTACAACAAATGATTAGGCGCTTT
>probe:Drosophila_2:1625532_at:396:679; Interrogation_Position=1569; Antisense; TAGGCGCTTTGAATTGTTTTACTTA
>probe:Drosophila_2:1625532_at:656:475; Interrogation_Position=1584; Antisense; GTTTTACTTATGAACCGGCCAAGAT
>probe:Drosophila_2:1625532_at:635:613; Interrogation_Position=1594; Antisense; TGAACCGGCCAAGATATATATATAT
>probe:Drosophila_2:1625532_at:693:509; Interrogation_Position=1710; Antisense; GTGCAATTACTTAGTTGACCACACT
>probe:Drosophila_2:1625532_at:563:609; Interrogation_Position=1725; Antisense; TGACCACACTTTGCTAACTTCTTCT
>probe:Drosophila_2:1625532_at:510:237; Interrogation_Position=1779; Antisense; AATCGTTGTCTTTTAATGCATGTCT
>probe:Drosophila_2:1625532_at:662:361; Interrogation_Position=1817; Antisense; GCAATCAAGGCTCTACAAACACTCA

Paste this into a BLAST search page for me
GTCCGTTCGATGGACCCGTGAACAAGATGGACCCGTGAACAACAACTACTCAACAACTACTGAGCGCGGTGCGATGCGGTGCGATCAGGATGCCATTCAAAGAAGCCCACATCTAACAAATTTAGTTTAGCTACTCAATTCAGTGACATTTTTACAACAAATGATTAGGCGCTTTTAGGCGCTTTGAATTGTTTTACTTAGTTTTACTTATGAACCGGCCAAGATTGAACCGGCCAAGATATATATATATGTGCAATTACTTAGTTGACCACACTTGACCACACTTTGCTAACTTCTTCTAATCGTTGTCTTTTAATGCATGTCTGCAATCAAGGCTCTACAAACACTCA

Full Affymetrix probeset data:

Annotations for 1625532_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime