FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625533_at:

>probe:Drosophila_2:1625533_at:33:157; Interrogation_Position=1010; Antisense; ACAGCCAACCGTCCGAAACTATGTG
>probe:Drosophila_2:1625533_at:400:19; Interrogation_Position=1064; Antisense; ATTTGATAGACTTTTCCCCGATGGC
>probe:Drosophila_2:1625533_at:121:633; Interrogation_Position=1078; Antisense; TCCCCGATGGCTTGTTTCCAAATGA
>probe:Drosophila_2:1625533_at:230:365; Interrogation_Position=1112; Antisense; GAATAGCCGCCGGAAGGCTTCTGAC
>probe:Drosophila_2:1625533_at:299:571; Interrogation_Position=1127; Antisense; GGCTTCTGACGCTAGAAATCTTCTT
>probe:Drosophila_2:1625533_at:620:287; Interrogation_Position=1182; Antisense; CGGATATCTGTGGACGAGGCTTTGA
>probe:Drosophila_2:1625533_at:453:607; Interrogation_Position=1238; Antisense; TGAGGAAGTGGATGCTCCCGCTCCG
>probe:Drosophila_2:1625533_at:26:283; Interrogation_Position=1258; Antisense; CTCCGGAGCCATATGATCACAGCGT
>probe:Drosophila_2:1625533_at:334:219; Interrogation_Position=1333; Antisense; AAGTCATGGACTACGAAGCACACAA
>probe:Drosophila_2:1625533_at:411:671; Interrogation_Position=1377; Antisense; TAGAGAACGACTTTTTCCTCCTTAG
>probe:Drosophila_2:1625533_at:177:699; Interrogation_Position=1388; Antisense; TTTTTCCTCCTTAGTCAGTCACAAG
>probe:Drosophila_2:1625533_at:183:207; Interrogation_Position=1420; Antisense; AAGCTTACCAACAATACGGCGTGTA
>probe:Drosophila_2:1625533_at:706:421; Interrogation_Position=969; Antisense; GAGCAATTAGGTACACCATCACCCT
>probe:Drosophila_2:1625533_at:130:33; Interrogation_Position=986; Antisense; ATCACCCTCGTTTATGCAACGGTTA

Paste this into a BLAST search page for me
ACAGCCAACCGTCCGAAACTATGTGATTTGATAGACTTTTCCCCGATGGCTCCCCGATGGCTTGTTTCCAAATGAGAATAGCCGCCGGAAGGCTTCTGACGGCTTCTGACGCTAGAAATCTTCTTCGGATATCTGTGGACGAGGCTTTGATGAGGAAGTGGATGCTCCCGCTCCGCTCCGGAGCCATATGATCACAGCGTAAGTCATGGACTACGAAGCACACAATAGAGAACGACTTTTTCCTCCTTAGTTTTTCCTCCTTAGTCAGTCACAAGAAGCTTACCAACAATACGGCGTGTAGAGCAATTAGGTACACCATCACCCTATCACCCTCGTTTATGCAACGGTTA

Full Affymetrix probeset data:

Annotations for 1625533_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720