Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625535_at:

>probe:Drosophila_2:1625535_at:322:291; Interrogation_Position=1968; Antisense; CGTCGCGTCTCAGTGACTTTGATAG
>probe:Drosophila_2:1625535_at:294:269; Interrogation_Position=1999; Antisense; CATGGATGCGTTCTTCTTCGACCAG
>probe:Drosophila_2:1625535_at:218:715; Interrogation_Position=2012; Antisense; TTCTTCGACCAGCACATGCGTACTG
>probe:Drosophila_2:1625535_at:287:607; Interrogation_Position=2064; Antisense; TGATGTCCCAATTGACTCCTCAGGA
>probe:Drosophila_2:1625535_at:208:51; Interrogation_Position=2094; Antisense; ATGCCGCATCAATGGCGCTGTTGGA
>probe:Drosophila_2:1625535_at:236:205; Interrogation_Position=2121; Antisense; AAGCCCGCCAGCACTTGCAGATGTT
>probe:Drosophila_2:1625535_at:82:99; Interrogation_Position=2139; Antisense; AGATGTTTGGACGATCGCCGTACAC
>probe:Drosophila_2:1625535_at:338:491; Interrogation_Position=2158; Antisense; GTACACGGAGATGTTGCTGCCACAT
>probe:Drosophila_2:1625535_at:548:627; Interrogation_Position=2175; Antisense; TGCCACATCTGTATCAGCGATCGGC
>probe:Drosophila_2:1625535_at:650:649; Interrogation_Position=2232; Antisense; TCAGCGCCTTTCAGCTGGGAATGTG
>probe:Drosophila_2:1625535_at:206:579; Interrogation_Position=2431; Antisense; GGCCAGACCCCAACTGAATCATTAT
>probe:Drosophila_2:1625535_at:658:365; Interrogation_Position=2446; Antisense; GAATCATTATCCTCAGCGGTTCAGT
>probe:Drosophila_2:1625535_at:276:541; Interrogation_Position=2463; Antisense; GGTTCAGTCCGTATCAGGTGCCCCA
>probe:Drosophila_2:1625535_at:187:129; Interrogation_Position=2503; Antisense; ACCAGCCTCCAATCGAGCAGAAAGT

Paste this into a BLAST search page for me
CGTCGCGTCTCAGTGACTTTGATAGCATGGATGCGTTCTTCTTCGACCAGTTCTTCGACCAGCACATGCGTACTGTGATGTCCCAATTGACTCCTCAGGAATGCCGCATCAATGGCGCTGTTGGAAAGCCCGCCAGCACTTGCAGATGTTAGATGTTTGGACGATCGCCGTACACGTACACGGAGATGTTGCTGCCACATTGCCACATCTGTATCAGCGATCGGCTCAGCGCCTTTCAGCTGGGAATGTGGGCCAGACCCCAACTGAATCATTATGAATCATTATCCTCAGCGGTTCAGTGGTTCAGTCCGTATCAGGTGCCCCAACCAGCCTCCAATCGAGCAGAAAGT

Full Affymetrix probeset data:

Annotations for 1625535_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime