FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625536_at:

>probe:Drosophila_2:1625536_at:542:457; Interrogation_Position=1646; Antisense; GATATGCTCACTATGCGATACCGTT
>probe:Drosophila_2:1625536_at:534:447; Interrogation_Position=1735; Antisense; GATGCCCTCAATCGGTATTTCATAG
>probe:Drosophila_2:1625536_at:57:19; Interrogation_Position=1751; Antisense; ATTTCATAGGCGGTCGTCAGCTGTT
>probe:Drosophila_2:1625536_at:15:403; Interrogation_Position=1777; Antisense; GACTTTGAGTCCTTCTTCGATGTAC
>probe:Drosophila_2:1625536_at:593:165; Interrogation_Position=1814; Antisense; AAATGCATTCCCGTTTGAACTTCAA
>probe:Drosophila_2:1625536_at:194:385; Interrogation_Position=1830; Antisense; GAACTTCAACTCTGACAGGCCAATG
>probe:Drosophila_2:1625536_at:326:569; Interrogation_Position=1880; Antisense; GGCTTCAAAAGCTTCAGCAGCGCCA
>probe:Drosophila_2:1625536_at:391:719; Interrogation_Position=1936; Antisense; TTCCATCTGGAACTCGGCAACGATA
>probe:Drosophila_2:1625536_at:93:257; Interrogation_Position=2006; Antisense; CAAATCCGGATACTTCGAGGGCCAC
>probe:Drosophila_2:1625536_at:204:429; Interrogation_Position=2022; Antisense; GAGGGCCACCACTCTGGACGAAGTA
>probe:Drosophila_2:1625536_at:699:575; Interrogation_Position=2036; Antisense; TGGACGAAGTAATGGCCGCCTTTGT
>probe:Drosophila_2:1625536_at:379:197; Interrogation_Position=2072; Antisense; AACGGATCGAGCTGCTCCTGGGAAA
>probe:Drosophila_2:1625536_at:717:23; Interrogation_Position=2096; Antisense; ATAGTTCAGAAACAGCCTCACCATC
>probe:Drosophila_2:1625536_at:301:647; Interrogation_Position=2119; Antisense; TCATCTGCATACTACCAGGCTGAGT

Paste this into a BLAST search page for me
GATATGCTCACTATGCGATACCGTTGATGCCCTCAATCGGTATTTCATAGATTTCATAGGCGGTCGTCAGCTGTTGACTTTGAGTCCTTCTTCGATGTACAAATGCATTCCCGTTTGAACTTCAAGAACTTCAACTCTGACAGGCCAATGGGCTTCAAAAGCTTCAGCAGCGCCATTCCATCTGGAACTCGGCAACGATACAAATCCGGATACTTCGAGGGCCACGAGGGCCACCACTCTGGACGAAGTATGGACGAAGTAATGGCCGCCTTTGTAACGGATCGAGCTGCTCCTGGGAAAATAGTTCAGAAACAGCCTCACCATCTCATCTGCATACTACCAGGCTGAGT

Full Affymetrix probeset data:

Annotations for 1625536_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720