FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625537_at:

>probe:Drosophila_2:1625537_at:19:193; Interrogation_Position=4213; Antisense; AACTATATGCGGATTAGGCCGATGT
>probe:Drosophila_2:1625537_at:551:599; Interrogation_Position=4235; Antisense; TGTAAATCGGACAAACTAGCAGGAT
>probe:Drosophila_2:1625537_at:260:543; Interrogation_Position=4279; Antisense; GGATTAGAGAAGCTGCTCAACCCAA
>probe:Drosophila_2:1625537_at:310:619; Interrogation_Position=4292; Antisense; TGCTCAACCCAATCCTTAAATGGTG
>probe:Drosophila_2:1625537_at:612:513; Interrogation_Position=4314; Antisense; GTGTTTATTACCGATCGACCATCAT
>probe:Drosophila_2:1625537_at:90:451; Interrogation_Position=4326; Antisense; GATCGACCATCATACCCAATATTCA
>probe:Drosophila_2:1625537_at:703:661; Interrogation_Position=4429; Antisense; TAACACAGCACACAAATACACCACG
>probe:Drosophila_2:1625537_at:39:157; Interrogation_Position=4446; Antisense; ACACCACGCACATTTCCTTATGTAA
>probe:Drosophila_2:1625537_at:267:27; Interrogation_Position=4488; Antisense; ATAGCAGCTTAGTCAAATTGTTGTT
>probe:Drosophila_2:1625537_at:478:377; Interrogation_Position=4513; Antisense; GAAGCTAGAAAGAGTCGTGTACAGT
>probe:Drosophila_2:1625537_at:575:539; Interrogation_Position=4549; Antisense; GGTTTGCCTGCCAAAACTATTCGAT
>probe:Drosophila_2:1625537_at:635:687; Interrogation_Position=4566; Antisense; TATTCGATAGTTTTACGACTACACA
>probe:Drosophila_2:1625537_at:462:265; Interrogation_Position=4644; Antisense; CAGTGTATTAATGTTAGTTGCTAGC
>probe:Drosophila_2:1625537_at:15:341; Interrogation_Position=4663; Antisense; GCTAGCTGATAAGGACAACCCGTGT

Paste this into a BLAST search page for me
AACTATATGCGGATTAGGCCGATGTTGTAAATCGGACAAACTAGCAGGATGGATTAGAGAAGCTGCTCAACCCAATGCTCAACCCAATCCTTAAATGGTGGTGTTTATTACCGATCGACCATCATGATCGACCATCATACCCAATATTCATAACACAGCACACAAATACACCACGACACCACGCACATTTCCTTATGTAAATAGCAGCTTAGTCAAATTGTTGTTGAAGCTAGAAAGAGTCGTGTACAGTGGTTTGCCTGCCAAAACTATTCGATTATTCGATAGTTTTACGACTACACACAGTGTATTAATGTTAGTTGCTAGCGCTAGCTGATAAGGACAACCCGTGT

Full Affymetrix probeset data:

Annotations for 1625537_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720