FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625538_at:

>probe:Drosophila_2:1625538_at:601:41; Interrogation_Position=263; Antisense; ATCGGAGGTGATGCAGTGACTGTCT
>probe:Drosophila_2:1625538_at:24:607; Interrogation_Position=271; Antisense; TGATGCAGTGACTGTCTACTTCGGA
>probe:Drosophila_2:1625538_at:510:729; Interrogation_Position=333; Antisense; TTGGAAGCGGCAACTTCATCACCCA
>probe:Drosophila_2:1625538_at:3:35; Interrogation_Position=350; Antisense; ATCACCCACGGATCTGCTGACATCG
>probe:Drosophila_2:1625538_at:196:141; Interrogation_Position=357; Antisense; ACGGATCTGCTGACATCGCCCTCAT
>probe:Drosophila_2:1625538_at:334:433; Interrogation_Position=563; Antisense; GAGTGCGCCAGCTACTACGGAACCG
>probe:Drosophila_2:1625538_at:467:109; Interrogation_Position=572; Antisense; AGCTACTACGGAACCGGCACCGTCG
>probe:Drosophila_2:1625538_at:196:381; Interrogation_Position=582; Antisense; GAACCGGCACCGTCGGCGACAACAT
>probe:Drosophila_2:1625538_at:478:397; Interrogation_Position=599; Antisense; GACAACATCATCTGCGTGCGCGTGG
>probe:Drosophila_2:1625538_at:700:271; Interrogation_Position=604; Antisense; CATCATCTGCGTGCGCGTGGTCGAT
>probe:Drosophila_2:1625538_at:127:141; Interrogation_Position=678; Antisense; ACGGCAGCAAGCTTGTGGGAGTCAC
>probe:Drosophila_2:1625538_at:705:115; Interrogation_Position=687; Antisense; AGCTTGTGGGAGTCACCAACTGGGT
>probe:Drosophila_2:1625538_at:729:341; Interrogation_Position=747; Antisense; GCTTCCAGCGTGTGACCTACCACTT
>probe:Drosophila_2:1625538_at:380:709; Interrogation_Position=802; Antisense; TTACTACTAAGCAACGATTTTCGAT

Paste this into a BLAST search page for me
ATCGGAGGTGATGCAGTGACTGTCTTGATGCAGTGACTGTCTACTTCGGATTGGAAGCGGCAACTTCATCACCCAATCACCCACGGATCTGCTGACATCGACGGATCTGCTGACATCGCCCTCATGAGTGCGCCAGCTACTACGGAACCGAGCTACTACGGAACCGGCACCGTCGGAACCGGCACCGTCGGCGACAACATGACAACATCATCTGCGTGCGCGTGGCATCATCTGCGTGCGCGTGGTCGATACGGCAGCAAGCTTGTGGGAGTCACAGCTTGTGGGAGTCACCAACTGGGTGCTTCCAGCGTGTGACCTACCACTTTTACTACTAAGCAACGATTTTCGAT

Full Affymetrix probeset data:

Annotations for 1625538_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720