FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625541_at:

>probe:Drosophila_2:1625541_at:292:679; Interrogation_Position=1008; Antisense; TAGGATTCGCTGTAGTTCGCACTTT
>probe:Drosophila_2:1625541_at:70:17; Interrogation_Position=1040; Antisense; ATTTTCGTGGCTTCTTCCATAAACG
>probe:Drosophila_2:1625541_at:303:171; Interrogation_Position=1075; Antisense; AAAGATTGTCACAGCCTTGAGGGAT
>probe:Drosophila_2:1625541_at:37:537; Interrogation_Position=1116; Antisense; GGTCCATAGAGGTTCAGCGCTTCAG
>probe:Drosophila_2:1625541_at:229:59; Interrogation_Position=1155; Antisense; ATGATACGACAGCTCTATCCGGCAG
>probe:Drosophila_2:1625541_at:688:129; Interrogation_Position=1226; Antisense; ACCATAATCACCTACGAGCTCATGA
>probe:Drosophila_2:1625541_at:4:407; Interrogation_Position=722; Antisense; GACTGCTTCATCATGTGCATTGGCA
>probe:Drosophila_2:1625541_at:582:627; Interrogation_Position=757; Antisense; TGCCAGATTTCACCAGCTCTATAGA
>probe:Drosophila_2:1625541_at:262:377; Interrogation_Position=780; Antisense; GAAGAATCGCTGCTGTTCATAGGAA
>probe:Drosophila_2:1625541_at:4:657; Interrogation_Position=807; Antisense; TAATGCCCGCGGTCTTTTGGACAGA
>probe:Drosophila_2:1625541_at:77:471; Interrogation_Position=833; Antisense; GTTCGGGAGCACTATCTGGCATTGA
>probe:Drosophila_2:1625541_at:285:379; Interrogation_Position=856; Antisense; GAAGCGTCTGGTTCATCTCCTGGAT
>probe:Drosophila_2:1625541_at:313:547; Interrogation_Position=877; Antisense; GGATGCGGCAATAGCTCCACTGGTG
>probe:Drosophila_2:1625541_at:569:57; Interrogation_Position=986; Antisense; ATGTTGGCTTTTTGGTACTCCTTAG

Paste this into a BLAST search page for me
TAGGATTCGCTGTAGTTCGCACTTTATTTTCGTGGCTTCTTCCATAAACGAAAGATTGTCACAGCCTTGAGGGATGGTCCATAGAGGTTCAGCGCTTCAGATGATACGACAGCTCTATCCGGCAGACCATAATCACCTACGAGCTCATGAGACTGCTTCATCATGTGCATTGGCATGCCAGATTTCACCAGCTCTATAGAGAAGAATCGCTGCTGTTCATAGGAATAATGCCCGCGGTCTTTTGGACAGAGTTCGGGAGCACTATCTGGCATTGAGAAGCGTCTGGTTCATCTCCTGGATGGATGCGGCAATAGCTCCACTGGTGATGTTGGCTTTTTGGTACTCCTTAG

Full Affymetrix probeset data:

Annotations for 1625541_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720