Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625544_s_at:

>probe:Drosophila_2:1625544_s_at:248:527; Interrogation_Position=120; Antisense; GGGCAATCGATTGAAGAGGAACATC
>probe:Drosophila_2:1625544_s_at:70:439; Interrogation_Position=135; Antisense; GAGGAACATCAAGCACACCGGGAGC
>probe:Drosophila_2:1625544_s_at:630:131; Interrogation_Position=151; Antisense; ACCGGGAGCCTGATTGTGCGCAAAC
>probe:Drosophila_2:1625544_s_at:571:465; Interrogation_Position=162; Antisense; GATTGTGCGCAAACTAACTGCCGGA
>probe:Drosophila_2:1625544_s_at:366:319; Interrogation_Position=168; Antisense; GCGCAAACTAACTGCCGGAAGGCAC
>probe:Drosophila_2:1625544_s_at:113:371; Interrogation_Position=185; Antisense; GAAGGCACAATGATGCGGACAAGAA
>probe:Drosophila_2:1625544_s_at:354:331; Interrogation_Position=250; Antisense; GCGGACACGGATAAGGAGAGACCAA
>probe:Drosophila_2:1625544_s_at:235:77; Interrogation_Position=263; Antisense; AGGAGAGACCAACCAGCAAGCCGGA
>probe:Drosophila_2:1625544_s_at:522:565; Interrogation_Position=289; Antisense; GGCAAGGTAGCCATGCTGCGCACCA
>probe:Drosophila_2:1625544_s_at:521:223; Interrogation_Position=292; Antisense; AAGGTAGCCATGCTGCGCACCACAA
>probe:Drosophila_2:1625544_s_at:186:257; Interrogation_Position=33; Antisense; CGTTGAAGGCGGCAAAACCAGTGAA
>probe:Drosophila_2:1625544_s_at:391:203; Interrogation_Position=48; Antisense; AACCAGTGAAGCCAAAGTCATTAGT
>probe:Drosophila_2:1625544_s_at:485:309; Interrogation_Position=59; Antisense; CCAAAGTCATTAGTGGTGGCAGTGG
>probe:Drosophila_2:1625544_s_at:413:265; Interrogation_Position=78; Antisense; CAGTGGGCAAAAGGTCAAAGGCGAT

Paste this into a BLAST search page for me
GGGCAATCGATTGAAGAGGAACATCGAGGAACATCAAGCACACCGGGAGCACCGGGAGCCTGATTGTGCGCAAACGATTGTGCGCAAACTAACTGCCGGAGCGCAAACTAACTGCCGGAAGGCACGAAGGCACAATGATGCGGACAAGAAGCGGACACGGATAAGGAGAGACCAAAGGAGAGACCAACCAGCAAGCCGGAGGCAAGGTAGCCATGCTGCGCACCAAAGGTAGCCATGCTGCGCACCACAACGTTGAAGGCGGCAAAACCAGTGAAAACCAGTGAAGCCAAAGTCATTAGTCCAAAGTCATTAGTGGTGGCAGTGGCAGTGGGCAAAAGGTCAAAGGCGAT

Full Affymetrix probeset data:

Annotations for 1625544_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime