Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625545_at:

>probe:Drosophila_2:1625545_at:153:135; Interrogation_Position=1270; Antisense; ACGCCCAAACTGTCAACGGATATAG
>probe:Drosophila_2:1625545_at:549:393; Interrogation_Position=1341; Antisense; GAAATCGCTGAGCTTCATTCGACGT
>probe:Drosophila_2:1625545_at:483:251; Interrogation_Position=1377; Antisense; CAAGGTGGCACGCAGCAATTCGCTG
>probe:Drosophila_2:1625545_at:666:41; Interrogation_Position=1431; Antisense; ATCGGGCAGTGGATCCAACGGACTC
>probe:Drosophila_2:1625545_at:405:639; Interrogation_Position=1454; Antisense; TCGGAGTCCATCAGGGCGTCATGCA
>probe:Drosophila_2:1625545_at:71:83; Interrogation_Position=1478; Antisense; AGGGAGCATTGTCCATCAGCTGTGC
>probe:Drosophila_2:1625545_at:709:713; Interrogation_Position=1543; Antisense; TTCTACCAGCCCTACGATGTGTGTC
>probe:Drosophila_2:1625545_at:366:63; Interrogation_Position=1559; Antisense; ATGTGTGTCCCTTGAGTCTGGACGA
>probe:Drosophila_2:1625545_at:537:117; Interrogation_Position=1583; Antisense; AGCTCAATTGCTATTTCCAGGCGGA
>probe:Drosophila_2:1625545_at:79:455; Interrogation_Position=1641; Antisense; GATCAGGGATCTGGCCATACACATG
>probe:Drosophila_2:1625545_at:656:247; Interrogation_Position=1680; Antisense; AATTGGAGCGGATCTCTCTGTGACC
>probe:Drosophila_2:1625545_at:499:271; Interrogation_Position=1747; Antisense; CATCATTCGGGTAGGTCGATTCACC
>probe:Drosophila_2:1625545_at:510:199; Interrogation_Position=1786; Antisense; AACGAAAATTCTTTGTCCCTGCTCA
>probe:Drosophila_2:1625545_at:632:503; Interrogation_Position=1800; Antisense; GTCCCTGCTCAATGGGCAGCAAGTA

Paste this into a BLAST search page for me
ACGCCCAAACTGTCAACGGATATAGGAAATCGCTGAGCTTCATTCGACGTCAAGGTGGCACGCAGCAATTCGCTGATCGGGCAGTGGATCCAACGGACTCTCGGAGTCCATCAGGGCGTCATGCAAGGGAGCATTGTCCATCAGCTGTGCTTCTACCAGCCCTACGATGTGTGTCATGTGTGTCCCTTGAGTCTGGACGAAGCTCAATTGCTATTTCCAGGCGGAGATCAGGGATCTGGCCATACACATGAATTGGAGCGGATCTCTCTGTGACCCATCATTCGGGTAGGTCGATTCACCAACGAAAATTCTTTGTCCCTGCTCAGTCCCTGCTCAATGGGCAGCAAGTA

Full Affymetrix probeset data:

Annotations for 1625545_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime