Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625546_at:

>probe:Drosophila_2:1625546_at:189:677; Interrogation_Position=2493; Antisense; TAGCAGTGAGTTGCAGCCACAGCTG
>probe:Drosophila_2:1625546_at:516:357; Interrogation_Position=2517; Antisense; GCAAATGCAGCTGCCGAAATCCCAG
>probe:Drosophila_2:1625546_at:440:319; Interrogation_Position=2562; Antisense; GCCCCTCAGTTTGGTGGACGACAGT
>probe:Drosophila_2:1625546_at:39:405; Interrogation_Position=2620; Antisense; GACTGGCAGGCGGACGACCTCGATT
>probe:Drosophila_2:1625546_at:569:531; Interrogation_Position=2658; Antisense; GGGTCGCCAGCAATCGGGCATCATC
>probe:Drosophila_2:1625546_at:188:223; Interrogation_Position=2684; Antisense; AAGGTGTACACCTGAGCTTTCTGGC
>probe:Drosophila_2:1625546_at:667:145; Interrogation_Position=2716; Antisense; ACAACGACCTTTGAGCACCTGCAGG
>probe:Drosophila_2:1625546_at:346:131; Interrogation_Position=2774; Antisense; ACCTGCAGTGGGAAGTGTCGCGCCT
>probe:Drosophila_2:1625546_at:453:317; Interrogation_Position=2795; Antisense; GCCTGCAAGCAGAGCGAAGCGTTCT
>probe:Drosophila_2:1625546_at:286:377; Interrogation_Position=2810; Antisense; GAAGCGTTCTCGACGCCGAGATATC
>probe:Drosophila_2:1625546_at:531:457; Interrogation_Position=2829; Antisense; GATATCCAATCTGACCATCGAGCTG
>probe:Drosophila_2:1625546_at:575:321; Interrogation_Position=2929; Antisense; GCCCTGCTCCAGATGTACGGCGAGA
>probe:Drosophila_2:1625546_at:164:41; Interrogation_Position=2984; Antisense; ATCTGACCGAGCTGAAGGCGGCCTA
>probe:Drosophila_2:1625546_at:431:359; Interrogation_Position=3054; Antisense; GCAACGGCCGTCGAAGCAAACATGA

Paste this into a BLAST search page for me
TAGCAGTGAGTTGCAGCCACAGCTGGCAAATGCAGCTGCCGAAATCCCAGGCCCCTCAGTTTGGTGGACGACAGTGACTGGCAGGCGGACGACCTCGATTGGGTCGCCAGCAATCGGGCATCATCAAGGTGTACACCTGAGCTTTCTGGCACAACGACCTTTGAGCACCTGCAGGACCTGCAGTGGGAAGTGTCGCGCCTGCCTGCAAGCAGAGCGAAGCGTTCTGAAGCGTTCTCGACGCCGAGATATCGATATCCAATCTGACCATCGAGCTGGCCCTGCTCCAGATGTACGGCGAGAATCTGACCGAGCTGAAGGCGGCCTAGCAACGGCCGTCGAAGCAAACATGA

Full Affymetrix probeset data:

Annotations for 1625546_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime