FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625548_at:

>probe:Drosophila_2:1625548_at:657:147; Interrogation_Position=1408; Antisense; ACTTCCGGCGGATGCAGAAACTACT
>probe:Drosophila_2:1625548_at:638:399; Interrogation_Position=1479; Antisense; GACAGCACTGGTAGATTCGTTGATC
>probe:Drosophila_2:1625548_at:273:725; Interrogation_Position=1498; Antisense; TTGATCCAACGATTGTCCGGGTGTC
>probe:Drosophila_2:1625548_at:189:49; Interrogation_Position=1525; Antisense; ATCCATTGGATCCACTGCTGTGTGA
>probe:Drosophila_2:1625548_at:35:139; Interrogation_Position=1591; Antisense; ACGATTCCTTCAGTGAGGCTCTCAA
>probe:Drosophila_2:1625548_at:528:631; Interrogation_Position=1647; Antisense; TCCGGCTCCATATTCGCAAGTCAGG
>probe:Drosophila_2:1625548_at:630:57; Interrogation_Position=1672; Antisense; ATGAGGTTATCCTTCACTGCCTGAA
>probe:Drosophila_2:1625548_at:81:371; Interrogation_Position=1705; Antisense; GAATGTCCGCTAGTAATCTCTACGT
>probe:Drosophila_2:1625548_at:676:139; Interrogation_Position=1743; Antisense; ACGGGTAGCACGTACGGGCTGACTC
>probe:Drosophila_2:1625548_at:319:503; Interrogation_Position=1758; Antisense; GGGCTGACTCCCTTTGGTGGAAATC
>probe:Drosophila_2:1625548_at:502:137; Interrogation_Position=1798; Antisense; ACGATAAATCCGGATCTGCCTACTT
>probe:Drosophila_2:1625548_at:342:627; Interrogation_Position=1814; Antisense; TGCCTACTTCCTAATGCGCTGGAGC
>probe:Drosophila_2:1625548_at:700:335; Interrogation_Position=1844; Antisense; GCTGCTCATCGAGGAGACTGTTGAT
>probe:Drosophila_2:1625548_at:638:163; Interrogation_Position=1892; Antisense; AAATACGTTTCCCTGAGCTTGCTGA

Paste this into a BLAST search page for me
ACTTCCGGCGGATGCAGAAACTACTGACAGCACTGGTAGATTCGTTGATCTTGATCCAACGATTGTCCGGGTGTCATCCATTGGATCCACTGCTGTGTGAACGATTCCTTCAGTGAGGCTCTCAATCCGGCTCCATATTCGCAAGTCAGGATGAGGTTATCCTTCACTGCCTGAAGAATGTCCGCTAGTAATCTCTACGTACGGGTAGCACGTACGGGCTGACTCGGGCTGACTCCCTTTGGTGGAAATCACGATAAATCCGGATCTGCCTACTTTGCCTACTTCCTAATGCGCTGGAGCGCTGCTCATCGAGGAGACTGTTGATAAATACGTTTCCCTGAGCTTGCTGA

Full Affymetrix probeset data:

Annotations for 1625548_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720