Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625549_at:

>probe:Drosophila_2:1625549_at:327:73; Interrogation_Position=1077; Antisense; AGGACCTGCGACTCTACAAGATCGG
>probe:Drosophila_2:1625549_at:294:295; Interrogation_Position=1117; Antisense; CGACTCCTGCATGCCAATTGGAATG
>probe:Drosophila_2:1625549_at:538:611; Interrogation_Position=1140; Antisense; TGAAGGCGGAGGACAACAAGACCAA
>probe:Drosophila_2:1625549_at:155:253; Interrogation_Position=1156; Antisense; CAAGACCAAGGTGGTGGCGGTTACA
>probe:Drosophila_2:1625549_at:429:653; Interrogation_Position=1194; Antisense; TAATCCATCATGTGCTGGCCCTCAG
>probe:Drosophila_2:1625549_at:705:647; Interrogation_Position=1215; Antisense; TCAGCTTTGCCGAGTCCGTGGAGGA
>probe:Drosophila_2:1625549_at:413:513; Interrogation_Position=1244; Antisense; GTGATTGGCACCAATGTGGCCGGCT
>probe:Drosophila_2:1625549_at:412:317; Interrogation_Position=1262; Antisense; GCCGGCTTTTGTTGCGTAACCGAAG
>probe:Drosophila_2:1625549_at:228:71; Interrogation_Position=1302; Antisense; AGGCAGTGATGTTGCTTTCGCCGCA
>probe:Drosophila_2:1625549_at:570:619; Interrogation_Position=1353; Antisense; TGCTCCTGTGGTCGGAACTGCAGTT
>probe:Drosophila_2:1625549_at:603:561; Interrogation_Position=1366; Antisense; GGAACTGCAGTTCATGGATAATCAT
>probe:Drosophila_2:1625549_at:297:543; Interrogation_Position=1381; Antisense; GGATAATCATACCTAGCATTTGTAA
>probe:Drosophila_2:1625549_at:564:345; Interrogation_Position=1396; Antisense; GCATTTGTAAATGCTCTGCTCTAGA
>probe:Drosophila_2:1625549_at:426:233; Interrogation_Position=1405; Antisense; AATGCTCTGCTCTAGATGTAATTTA

Paste this into a BLAST search page for me
AGGACCTGCGACTCTACAAGATCGGCGACTCCTGCATGCCAATTGGAATGTGAAGGCGGAGGACAACAAGACCAACAAGACCAAGGTGGTGGCGGTTACATAATCCATCATGTGCTGGCCCTCAGTCAGCTTTGCCGAGTCCGTGGAGGAGTGATTGGCACCAATGTGGCCGGCTGCCGGCTTTTGTTGCGTAACCGAAGAGGCAGTGATGTTGCTTTCGCCGCATGCTCCTGTGGTCGGAACTGCAGTTGGAACTGCAGTTCATGGATAATCATGGATAATCATACCTAGCATTTGTAAGCATTTGTAAATGCTCTGCTCTAGAAATGCTCTGCTCTAGATGTAATTTA

Full Affymetrix probeset data:

Annotations for 1625549_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime