FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625550_at:

>probe:Drosophila_2:1625550_at:326:649; Interrogation_Position=1019; Antisense; TCAGATATCCGGCTCTACTTGTATA
>probe:Drosophila_2:1625550_at:449:687; Interrogation_Position=1040; Antisense; TATACCTCGAGCTATTGCATCCTTA
>probe:Drosophila_2:1625550_at:320:225; Interrogation_Position=1072; Antisense; AAGGAGCGGCACAAGTTCTCGACAA
>probe:Drosophila_2:1625550_at:10:471; Interrogation_Position=1086; Antisense; GTTCTCGACAAATGGCTTTACTCAA
>probe:Drosophila_2:1625550_at:243:123; Interrogation_Position=1147; Antisense; AGCGACTCGGTATGCATGACTTTAA
>probe:Drosophila_2:1625550_at:156:463; Interrogation_Position=629; Antisense; GATTCAGCCCTGAAACGTATCCAAA
>probe:Drosophila_2:1625550_at:583:339; Interrogation_Position=745; Antisense; GCTTTGGACGTGTTTCGTAGTCTAC
>probe:Drosophila_2:1625550_at:14:287; Interrogation_Position=760; Antisense; CGTAGTCTACGCACAGGAAACCATA
>probe:Drosophila_2:1625550_at:224:65; Interrogation_Position=787; Antisense; ATGGGAGCTCTTATATGGCAGTTAA
>probe:Drosophila_2:1625550_at:113:199; Interrogation_Position=811; Antisense; AACGATGTTTGGGTGGCTCCAACTT
>probe:Drosophila_2:1625550_at:333:535; Interrogation_Position=836; Antisense; GGTCCTGCATCGACTTCTACGGAAA
>probe:Drosophila_2:1625550_at:590:191; Interrogation_Position=890; Antisense; AACTTCTTGCCCCAACGAGTGTTAT
>probe:Drosophila_2:1625550_at:327:213; Interrogation_Position=950; Antisense; AAGAGAGGACTTCTCCGAGCATAGA
>probe:Drosophila_2:1625550_at:159:425; Interrogation_Position=973; Antisense; GAGACTCGCGGTTATACCATGTACT

Paste this into a BLAST search page for me
TCAGATATCCGGCTCTACTTGTATATATACCTCGAGCTATTGCATCCTTAAAGGAGCGGCACAAGTTCTCGACAAGTTCTCGACAAATGGCTTTACTCAAAGCGACTCGGTATGCATGACTTTAAGATTCAGCCCTGAAACGTATCCAAAGCTTTGGACGTGTTTCGTAGTCTACCGTAGTCTACGCACAGGAAACCATAATGGGAGCTCTTATATGGCAGTTAAAACGATGTTTGGGTGGCTCCAACTTGGTCCTGCATCGACTTCTACGGAAAAACTTCTTGCCCCAACGAGTGTTATAAGAGAGGACTTCTCCGAGCATAGAGAGACTCGCGGTTATACCATGTACT

Full Affymetrix probeset data:

Annotations for 1625550_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720