Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625551_at:

>probe:Drosophila_2:1625551_at:292:473; Interrogation_Position=2115; Antisense; GTTAAAGACGCACAGCACCGTGTCG
>probe:Drosophila_2:1625551_at:229:261; Interrogation_Position=2130; Antisense; CACCGTGTCGCAGGCTATTCAGCAG
>probe:Drosophila_2:1625551_at:292:329; Interrogation_Position=2157; Antisense; GCGGAATATGAACGCCCGCCATACG
>probe:Drosophila_2:1625551_at:400:351; Interrogation_Position=2199; Antisense; GCAGCGTTACGCTAAGTGCCCGCGA
>probe:Drosophila_2:1625551_at:463:507; Interrogation_Position=2214; Antisense; GTGCCCGCGATTACCGAGTGATGAG
>probe:Drosophila_2:1625551_at:589:359; Interrogation_Position=2244; Antisense; GCAACGAGTTGCAATAGCCTTTGAT
>probe:Drosophila_2:1625551_at:129:611; Interrogation_Position=2279; Antisense; TGACCGTTGAGGATCTGCAGCACTA
>probe:Drosophila_2:1625551_at:50:79; Interrogation_Position=2288; Antisense; AGGATCTGCAGCACTACCACAAGCT
>probe:Drosophila_2:1625551_at:203:701; Interrogation_Position=2324; Antisense; TTTTCGCGATGTACGCCGAGTACAC
>probe:Drosophila_2:1625551_at:580:211; Interrogation_Position=2351; Antisense; AAGAACTGGAGCAGCGGGCTGTCAA
>probe:Drosophila_2:1625551_at:353:457; Interrogation_Position=2420; Antisense; GATTGCCGGCAAGTTAATCCGGATA
>probe:Drosophila_2:1625551_at:567:73; Interrogation_Position=2463; Antisense; AGGAGCTACTGTTAATCTTATGTCA
>probe:Drosophila_2:1625551_at:176:567; Interrogation_Position=2590; Antisense; GGCACCTTTGCTTGTATCTGTATAT
>probe:Drosophila_2:1625551_at:360:217; Interrogation_Position=2645; Antisense; AAGTTATTTGTATGATCCAACCCAA

Paste this into a BLAST search page for me
GTTAAAGACGCACAGCACCGTGTCGCACCGTGTCGCAGGCTATTCAGCAGGCGGAATATGAACGCCCGCCATACGGCAGCGTTACGCTAAGTGCCCGCGAGTGCCCGCGATTACCGAGTGATGAGGCAACGAGTTGCAATAGCCTTTGATTGACCGTTGAGGATCTGCAGCACTAAGGATCTGCAGCACTACCACAAGCTTTTTCGCGATGTACGCCGAGTACACAAGAACTGGAGCAGCGGGCTGTCAAGATTGCCGGCAAGTTAATCCGGATAAGGAGCTACTGTTAATCTTATGTCAGGCACCTTTGCTTGTATCTGTATATAAGTTATTTGTATGATCCAACCCAA

Full Affymetrix probeset data:

Annotations for 1625551_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime