FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625552_at:

>probe:Drosophila_2:1625552_at:675:167; Interrogation_Position=1010; Antisense; AAATGATGCACGTAGCCAAGGGCTT
>probe:Drosophila_2:1625552_at:163:223; Interrogation_Position=1027; Antisense; AAGGGCTTCTCGGATGCTCTATATA
>probe:Drosophila_2:1625552_at:716:565; Interrogation_Position=1060; Antisense; GGCACAGTATTTACCTATGGATCCA
>probe:Drosophila_2:1625552_at:315:545; Interrogation_Position=1078; Antisense; GGATCCAGTGCTACAACATTATATG
>probe:Drosophila_2:1625552_at:404:259; Interrogation_Position=1156; Antisense; CACTATACCATAGAGCTGCGCGATA
>probe:Drosophila_2:1625552_at:325:563; Interrogation_Position=1183; Antisense; GGCGAATTGGGCTTTGTCCTTCCTC
>probe:Drosophila_2:1625552_at:205:21; Interrogation_Position=1214; Antisense; ATATTATTCCAGTGGCACGCGAGGT
>probe:Drosophila_2:1625552_at:629:11; Interrogation_Position=1248; Antisense; ATTCGTGGGCATGATAGCCGCTGCA
>probe:Drosophila_2:1625552_at:718:319; Interrogation_Position=1264; Antisense; GCCGCTGCACGGGAAATCGATATAT
>probe:Drosophila_2:1625552_at:428:207; Interrogation_Position=1366; Antisense; AATGAACTTCTCCACAAAACTTGTA
>probe:Drosophila_2:1625552_at:409:97; Interrogation_Position=869; Antisense; AGATCAGTCAACTAACCGCCTACAT
>probe:Drosophila_2:1625552_at:146:181; Interrogation_Position=894; Antisense; AAACAACTCCATACCTGAAGGCACT
>probe:Drosophila_2:1625552_at:91:683; Interrogation_Position=930; Antisense; TATCTCATTGCATTCCTATGGACAG
>probe:Drosophila_2:1625552_at:247:67; Interrogation_Position=947; Antisense; ATGGACAGTATGTTCTTTCGCCTTG

Paste this into a BLAST search page for me
AAATGATGCACGTAGCCAAGGGCTTAAGGGCTTCTCGGATGCTCTATATAGGCACAGTATTTACCTATGGATCCAGGATCCAGTGCTACAACATTATATGCACTATACCATAGAGCTGCGCGATAGGCGAATTGGGCTTTGTCCTTCCTCATATTATTCCAGTGGCACGCGAGGTATTCGTGGGCATGATAGCCGCTGCAGCCGCTGCACGGGAAATCGATATATAATGAACTTCTCCACAAAACTTGTAAGATCAGTCAACTAACCGCCTACATAAACAACTCCATACCTGAAGGCACTTATCTCATTGCATTCCTATGGACAGATGGACAGTATGTTCTTTCGCCTTG

Full Affymetrix probeset data:

Annotations for 1625552_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720