FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625553_at:

>probe:Drosophila_2:1625553_at:33:679; Interrogation_Position=1027; Antisense; TATAATTTCGCAGTACCTTGCCTTG
>probe:Drosophila_2:1625553_at:228:307; Interrogation_Position=1042; Antisense; CCTTGCCTTGCACCGAATGTTAATG
>probe:Drosophila_2:1625553_at:712:371; Interrogation_Position=1119; Antisense; GAAGGTGTACCTATTCATGAACCGA
>probe:Drosophila_2:1625553_at:566:645; Interrogation_Position=1133; Antisense; TCATGAACCGAAATCCAGTTTATGG
>probe:Drosophila_2:1625553_at:625:405; Interrogation_Position=1157; Antisense; GAGAAGAGTATTCAGTTTTCACAAC
>probe:Drosophila_2:1625553_at:81:695; Interrogation_Position=1173; Antisense; TTTCACAACTATGCCGAGCCTGGGA
>probe:Drosophila_2:1625553_at:323:387; Interrogation_Position=1200; Antisense; GAAAAACTTTGCTGTCAACCTGACT
>probe:Drosophila_2:1625553_at:609:597; Interrogation_Position=1212; Antisense; TGTCAACCTGACTGTAGATACCAAT
>probe:Drosophila_2:1625553_at:697:323; Interrogation_Position=1323; Antisense; GCGAATCGTATACAATCGTTGTTAT
>probe:Drosophila_2:1625553_at:617:599; Interrogation_Position=1342; Antisense; TGTTATTTCCATCGATGTACGGCCC
>probe:Drosophila_2:1625553_at:266:487; Interrogation_Position=1358; Antisense; GTACGGCCCGATTCTACAATACGAA
>probe:Drosophila_2:1625553_at:648:339; Interrogation_Position=1431; Antisense; GCTATTGGCACATGTAGTGCGTTTC
>probe:Drosophila_2:1625553_at:11:395; Interrogation_Position=908; Antisense; GAAATGTCTCATTCAGCTTAGCTGA
>probe:Drosophila_2:1625553_at:114:431; Interrogation_Position=949; Antisense; GAGTATCCCATCTATAATCAAAGCT

Paste this into a BLAST search page for me
TATAATTTCGCAGTACCTTGCCTTGCCTTGCCTTGCACCGAATGTTAATGGAAGGTGTACCTATTCATGAACCGATCATGAACCGAAATCCAGTTTATGGGAGAAGAGTATTCAGTTTTCACAACTTTCACAACTATGCCGAGCCTGGGAGAAAAACTTTGCTGTCAACCTGACTTGTCAACCTGACTGTAGATACCAATGCGAATCGTATACAATCGTTGTTATTGTTATTTCCATCGATGTACGGCCCGTACGGCCCGATTCTACAATACGAAGCTATTGGCACATGTAGTGCGTTTCGAAATGTCTCATTCAGCTTAGCTGAGAGTATCCCATCTATAATCAAAGCT

Full Affymetrix probeset data:

Annotations for 1625553_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720