FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625554_at:

>probe:Drosophila_2:1625554_at:659:683; Interrogation_Position=491; Antisense; TATCGAGTGCCGTCACTATGGAGCC
>probe:Drosophila_2:1625554_at:188:163; Interrogation_Position=536; Antisense; AAATTGTGGACTGTACTTCATCTGC
>probe:Drosophila_2:1625554_at:183:645; Interrogation_Position=572; Antisense; TCTACATCGTCATCAGTGTGGGCGT
>probe:Drosophila_2:1625554_at:586:327; Interrogation_Position=593; Antisense; GCGTGGCACTGCTTGGAATTTCGAG
>probe:Drosophila_2:1625554_at:627:105; Interrogation_Position=616; Antisense; AGAAATCCGAGTGCCAGTTGAGTGA
>probe:Drosophila_2:1625554_at:595:367; Interrogation_Position=660; Antisense; GAATCGCAGATTTCCGAGCCGCATA
>probe:Drosophila_2:1625554_at:398:393; Interrogation_Position=704; Antisense; GAAAGTTCCCACAGCCAACAGTGAA
>probe:Drosophila_2:1625554_at:309:493; Interrogation_Position=735; Antisense; GTAACCGTTTGCTATATCGTCGGAT
>probe:Drosophila_2:1625554_at:694:545; Interrogation_Position=756; Antisense; GGATCGAGTGAGTACACCACCCTGC
>probe:Drosophila_2:1625554_at:66:617; Interrogation_Position=778; Antisense; TGCAGCAATTCCTTACGAGTCCAGA
>probe:Drosophila_2:1625554_at:57:433; Interrogation_Position=794; Antisense; GAGTCCAGAGATCACCGAGTTGCCT
>probe:Drosophila_2:1625554_at:242:103; Interrogation_Position=883; Antisense; AGAGCTACATGTCCCATCCGGAGGA
>probe:Drosophila_2:1625554_at:110:219; Interrogation_Position=915; Antisense; AAGTACTATATCTGCATCGGAGGAA
>probe:Drosophila_2:1625554_at:141:439; Interrogation_Position=934; Antisense; GAGGAATGCCAGTGCTCACATCCTG

Paste this into a BLAST search page for me
TATCGAGTGCCGTCACTATGGAGCCAAATTGTGGACTGTACTTCATCTGCTCTACATCGTCATCAGTGTGGGCGTGCGTGGCACTGCTTGGAATTTCGAGAGAAATCCGAGTGCCAGTTGAGTGAGAATCGCAGATTTCCGAGCCGCATAGAAAGTTCCCACAGCCAACAGTGAAGTAACCGTTTGCTATATCGTCGGATGGATCGAGTGAGTACACCACCCTGCTGCAGCAATTCCTTACGAGTCCAGAGAGTCCAGAGATCACCGAGTTGCCTAGAGCTACATGTCCCATCCGGAGGAAAGTACTATATCTGCATCGGAGGAAGAGGAATGCCAGTGCTCACATCCTG

Full Affymetrix probeset data:

Annotations for 1625554_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720