Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625556_at:

>probe:Drosophila_2:1625556_at:492:239; Interrogation_Position=2452; Antisense; AATACAACGCCTTGCGCAGAACGTT
>probe:Drosophila_2:1625556_at:361:663; Interrogation_Position=2499; Antisense; TAAAGCCCTAGCGATACCGATACCG
>probe:Drosophila_2:1625556_at:283:265; Interrogation_Position=2583; Antisense; CAGACGCATTTCAGTGGCCAAGTGT
>probe:Drosophila_2:1625556_at:348:145; Interrogation_Position=2626; Antisense; ACTAGCCCAAACGACCCGATGAAAT
>probe:Drosophila_2:1625556_at:139:27; Interrogation_Position=2677; Antisense; ATAGCGCCGCAAGTCAAGCAATTAT
>probe:Drosophila_2:1625556_at:118:173; Interrogation_Position=2707; Antisense; AAAGACCGCCTAAGCAGATCGGCTC
>probe:Drosophila_2:1625556_at:452:97; Interrogation_Position=2722; Antisense; AGATCGGCTCATCGGTTAGACCCTA
>probe:Drosophila_2:1625556_at:211:663; Interrogation_Position=2752; Antisense; TAAACCTTGTATTAGCCCCGCGTGA
>probe:Drosophila_2:1625556_at:234:301; Interrogation_Position=2767; Antisense; CCCCGCGTGAACAGCATCAAGTATT
>probe:Drosophila_2:1625556_at:385:217; Interrogation_Position=2785; Antisense; AAGTATTCGCAATCTGTATCTCGTA
>probe:Drosophila_2:1625556_at:332:483; Interrogation_Position=2800; Antisense; GTATCTCGTAACTAATCGCAGCACA
>probe:Drosophila_2:1625556_at:39:377; Interrogation_Position=2852; Antisense; GAACGAAGATAGATACTCCCCGTCC
>probe:Drosophila_2:1625556_at:237:471; Interrogation_Position=2885; Antisense; GTTCCTTTTGATTCTCACTCGATTC
>probe:Drosophila_2:1625556_at:552:483; Interrogation_Position=2965; Antisense; GTATGCTTATGCGACTGAATTTGAA

Paste this into a BLAST search page for me
AATACAACGCCTTGCGCAGAACGTTTAAAGCCCTAGCGATACCGATACCGCAGACGCATTTCAGTGGCCAAGTGTACTAGCCCAAACGACCCGATGAAATATAGCGCCGCAAGTCAAGCAATTATAAAGACCGCCTAAGCAGATCGGCTCAGATCGGCTCATCGGTTAGACCCTATAAACCTTGTATTAGCCCCGCGTGACCCCGCGTGAACAGCATCAAGTATTAAGTATTCGCAATCTGTATCTCGTAGTATCTCGTAACTAATCGCAGCACAGAACGAAGATAGATACTCCCCGTCCGTTCCTTTTGATTCTCACTCGATTCGTATGCTTATGCGACTGAATTTGAA

Full Affymetrix probeset data:

Annotations for 1625556_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime