Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625558_a_at:

>probe:Drosophila_2:1625558_a_at:437:551; Interrogation_Position=112; Antisense; GGAGCTTTCTGGCTACGACTACCAG
>probe:Drosophila_2:1625558_a_at:664:111; Interrogation_Position=14; Antisense; AGCACACATCTTTCGTTGAGCGCAG
>probe:Drosophila_2:1625558_a_at:87:469; Interrogation_Position=28; Antisense; GTTGAGCGCAGTCTAAACACTTGAA
>probe:Drosophila_2:1625558_a_at:603:495; Interrogation_Position=342; Antisense; GTCACCGCAACTAAGATGAAAGCCA
>probe:Drosophila_2:1625558_a_at:476:5; Interrogation_Position=373; Antisense; ATTGTTAATTTGTTGACTCGAGTGC
>probe:Drosophila_2:1625558_a_at:595:603; Interrogation_Position=383; Antisense; TGTTGACTCGAGTGCAATTGCTGAA
>probe:Drosophila_2:1625558_a_at:425:361; Interrogation_Position=396; Antisense; GCAATTGCTGAATACCATCTTTAGA
>probe:Drosophila_2:1625558_a_at:193:307; Interrogation_Position=410; Antisense; CCATCTTTAGAAATTCACTTGGAGA
>probe:Drosophila_2:1625558_a_at:299:47; Interrogation_Position=454; Antisense; AAATTATTCGTTGTCTTGTCCTTCT
>probe:Drosophila_2:1625558_a_at:578:273; Interrogation_Position=468; Antisense; CTTGTCCTTCTTTGGTTGCTATCAA
>probe:Drosophila_2:1625558_a_at:528:275; Interrogation_Position=486; Antisense; CTATCAAAGTTGAGTTCGCAGGAAA
>probe:Drosophila_2:1625558_a_at:398:269; Interrogation_Position=55; Antisense; CATGAAATTCCTGATCATTGCCATC
>probe:Drosophila_2:1625558_a_at:202:645; Interrogation_Position=84; Antisense; TCTTGGCCTGCGCATTCGCCGATGT
>probe:Drosophila_2:1625558_a_at:227:11; Interrogation_Position=97; Antisense; ATTCGCCGATGTCTCGGAGCTTTCT

Paste this into a BLAST search page for me
GGAGCTTTCTGGCTACGACTACCAGAGCACACATCTTTCGTTGAGCGCAGGTTGAGCGCAGTCTAAACACTTGAAGTCACCGCAACTAAGATGAAAGCCAATTGTTAATTTGTTGACTCGAGTGCTGTTGACTCGAGTGCAATTGCTGAAGCAATTGCTGAATACCATCTTTAGACCATCTTTAGAAATTCACTTGGAGAAAATTATTCGTTGTCTTGTCCTTCTCTTGTCCTTCTTTGGTTGCTATCAACTATCAAAGTTGAGTTCGCAGGAAACATGAAATTCCTGATCATTGCCATCTCTTGGCCTGCGCATTCGCCGATGTATTCGCCGATGTCTCGGAGCTTTCT

Full Affymetrix probeset data:

Annotations for 1625558_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime