Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625564_at:

>probe:Drosophila_2:1625564_at:702:591; Interrogation_Position=1017; Antisense; TGGTGCAGCAGATCTATTCCCTCAA
>probe:Drosophila_2:1625564_at:484:123; Interrogation_Position=1055; Antisense; AGCGACTGCGCCAAAAAGTTCATAT
>probe:Drosophila_2:1625564_at:288:473; Interrogation_Position=1072; Antisense; GTTCATATCGAACCACCAAGTAGGA
>probe:Drosophila_2:1625564_at:322:217; Interrogation_Position=1089; Antisense; AAGTAGGACTCATTCTCTTCCTCGG
>probe:Drosophila_2:1625564_at:210:715; Interrogation_Position=1119; Antisense; TTCTGGGCACCCTTCTGAAATCAGA
>probe:Drosophila_2:1625564_at:207:107; Interrogation_Position=1152; Antisense; AGAAACAGCGACAATCCTCACTAAC
>probe:Drosophila_2:1625564_at:12:663; Interrogation_Position=1173; Antisense; TAACAACATCGACGGCCAGCTCGTA
>probe:Drosophila_2:1625564_at:562:121; Interrogation_Position=1204; Antisense; AGCGCTGCCGCAAAAGCCAGAAGTT
>probe:Drosophila_2:1625564_at:311:27; Interrogation_Position=1280; Antisense; ATAGCGCGCTTTTTGATTCGCCAAA
>probe:Drosophila_2:1625564_at:680:463; Interrogation_Position=1294; Antisense; GATTCGCCAAAACCAAAGTCTCTAG
>probe:Drosophila_2:1625564_at:427:413; Interrogation_Position=1355; Antisense; GACCATTTTTAGCTCATTTGCAATA
>probe:Drosophila_2:1625564_at:278:645; Interrogation_Position=1435; Antisense; TCTTAATTGTAAGTGCCCGCCTTGA
>probe:Drosophila_2:1625564_at:227:507; Interrogation_Position=1447; Antisense; GTGCCCGCCTTGACGTAAGAACTTA
>probe:Drosophila_2:1625564_at:512:411; Interrogation_Position=1491; Antisense; GAGCCCTCCTAACCCATTTGAAAAG

Paste this into a BLAST search page for me
TGGTGCAGCAGATCTATTCCCTCAAAGCGACTGCGCCAAAAAGTTCATATGTTCATATCGAACCACCAAGTAGGAAAGTAGGACTCATTCTCTTCCTCGGTTCTGGGCACCCTTCTGAAATCAGAAGAAACAGCGACAATCCTCACTAACTAACAACATCGACGGCCAGCTCGTAAGCGCTGCCGCAAAAGCCAGAAGTTATAGCGCGCTTTTTGATTCGCCAAAGATTCGCCAAAACCAAAGTCTCTAGGACCATTTTTAGCTCATTTGCAATATCTTAATTGTAAGTGCCCGCCTTGAGTGCCCGCCTTGACGTAAGAACTTAGAGCCCTCCTAACCCATTTGAAAAG

Full Affymetrix probeset data:

Annotations for 1625564_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime