Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625565_at:

>probe:Drosophila_2:1625565_at:29:33; Interrogation_Position=1019; Antisense; ATAAGCTGTTTGAGCCGTGGCGCCT
>probe:Drosophila_2:1625565_at:69:323; Interrogation_Position=1038; Antisense; GCGCCTCTTCATGGAGCGTGAGTGA
>probe:Drosophila_2:1625565_at:110:421; Interrogation_Position=1066; Antisense; GAGCAGATCCGAGTTCAAGTTCCTA
>probe:Drosophila_2:1625565_at:30:471; Interrogation_Position=1084; Antisense; GTTCCTATTTAGCAGTGATTCCTTT
>probe:Drosophila_2:1625565_at:691:699; Interrogation_Position=1118; Antisense; TTATTTTTGCCCAATCTTAGCCCTT
>probe:Drosophila_2:1625565_at:600:645; Interrogation_Position=1132; Antisense; TCTTAGCCCTTGTAAATACCCTTGT
>probe:Drosophila_2:1625565_at:661:239; Interrogation_Position=1146; Antisense; AATACCCTTGTTAAATTAGCCATAG
>probe:Drosophila_2:1625565_at:526:673; Interrogation_Position=1162; Antisense; TAGCCATAGTTTTGCGGTGGTCAGT
>probe:Drosophila_2:1625565_at:423:533; Interrogation_Position=1177; Antisense; GGTGGTCAGTGTGCGTATCATCTAC
>probe:Drosophila_2:1625565_at:581:507; Interrogation_Position=1187; Antisense; GTGCGTATCATCTACTTACACCGAA
>probe:Drosophila_2:1625565_at:429:245; Interrogation_Position=1210; Antisense; AATTGTTGCCAAAATGTAGTCCCAT
>probe:Drosophila_2:1625565_at:245:699; Interrogation_Position=883; Antisense; TTTAAATCGCGGGATGCACCGGCTC
>probe:Drosophila_2:1625565_at:261:573; Interrogation_Position=903; Antisense; GGCTCCGACCGAATGCGACTCTTGA
>probe:Drosophila_2:1625565_at:523:645; Interrogation_Position=922; Antisense; TCTTGACGCGCTTTGCACGTGAAAA

Paste this into a BLAST search page for me
ATAAGCTGTTTGAGCCGTGGCGCCTGCGCCTCTTCATGGAGCGTGAGTGAGAGCAGATCCGAGTTCAAGTTCCTAGTTCCTATTTAGCAGTGATTCCTTTTTATTTTTGCCCAATCTTAGCCCTTTCTTAGCCCTTGTAAATACCCTTGTAATACCCTTGTTAAATTAGCCATAGTAGCCATAGTTTTGCGGTGGTCAGTGGTGGTCAGTGTGCGTATCATCTACGTGCGTATCATCTACTTACACCGAAAATTGTTGCCAAAATGTAGTCCCATTTTAAATCGCGGGATGCACCGGCTCGGCTCCGACCGAATGCGACTCTTGATCTTGACGCGCTTTGCACGTGAAAA

Full Affymetrix probeset data:

Annotations for 1625565_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime