Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625566_a_at:

>probe:Drosophila_2:1625566_a_at:397:407; Interrogation_Position=403; Antisense; GACTGGACAACGATTTAGCACGCTT
>probe:Drosophila_2:1625566_a_at:43:463; Interrogation_Position=437; Antisense; GATTCAGGAGAAGGCCTCATCCACG
>probe:Drosophila_2:1625566_a_at:713:47; Interrogation_Position=455; Antisense; ATCCACGCGTGCCAAATCCGAGGAA
>probe:Drosophila_2:1625566_a_at:26:105; Interrogation_Position=535; Antisense; AGAAAAAGTCCGCATCCTCGGATGA
>probe:Drosophila_2:1625566_a_at:377:523; Interrogation_Position=567; Antisense; GGGCGCGGCAACAACCAATCTAACG
>probe:Drosophila_2:1625566_a_at:359:247; Interrogation_Position=582; Antisense; CAATCTAACGCCAATTCCAGTGTCA
>probe:Drosophila_2:1625566_a_at:412:721; Interrogation_Position=596; Antisense; TTCCAGTGTCAATTCGAGCAGCAAT
>probe:Drosophila_2:1625566_a_at:479:145; Interrogation_Position=705; Antisense; ACTCATCCCAGCGACGTTATGGACA
>probe:Drosophila_2:1625566_a_at:40:233; Interrogation_Position=744; Antisense; AATGAGCCCACATATTGCCTATGCC
>probe:Drosophila_2:1625566_a_at:511:47; Interrogation_Position=764; Antisense; ATGCCACCAGGTGTCCTATGGAGAG
>probe:Drosophila_2:1625566_a_at:403:57; Interrogation_Position=789; Antisense; ATGATTGGCTGCGACAATCCCGACT
>probe:Drosophila_2:1625566_a_at:242:407; Interrogation_Position=810; Antisense; GACTGTCCCATCGAGTGGTTTCACT
>probe:Drosophila_2:1625566_a_at:710:697; Interrogation_Position=828; Antisense; TTTCACTTCGCTTGTGTTGGCCTCA
>probe:Drosophila_2:1625566_a_at:320:221; Interrogation_Position=870; Antisense; AAGTGGTTCTGTCCCAAGTGTACGC

Paste this into a BLAST search page for me
GACTGGACAACGATTTAGCACGCTTGATTCAGGAGAAGGCCTCATCCACGATCCACGCGTGCCAAATCCGAGGAAAGAAAAAGTCCGCATCCTCGGATGAGGGCGCGGCAACAACCAATCTAACGCAATCTAACGCCAATTCCAGTGTCATTCCAGTGTCAATTCGAGCAGCAATACTCATCCCAGCGACGTTATGGACAAATGAGCCCACATATTGCCTATGCCATGCCACCAGGTGTCCTATGGAGAGATGATTGGCTGCGACAATCCCGACTGACTGTCCCATCGAGTGGTTTCACTTTTCACTTCGCTTGTGTTGGCCTCAAAGTGGTTCTGTCCCAAGTGTACGC

Full Affymetrix probeset data:

Annotations for 1625566_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime