Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625567_a_at:

>probe:Drosophila_2:1625567_a_at:23:377; Interrogation_Position=407; Antisense; GAAGAAGATCTTTGTCCCAGACAAG
>probe:Drosophila_2:1625567_a_at:308:191; Interrogation_Position=453; Antisense; AACATTGCGCTGATGATGCTGGCCA
>probe:Drosophila_2:1625567_a_at:3:441; Interrogation_Position=467; Antisense; GATGCTGGCCAAAAAACTACCCTTG
>probe:Drosophila_2:1625567_a_at:717:161; Interrogation_Position=493; Antisense; ACAATCCGCTTGTGGGTGTGATCAA
>probe:Drosophila_2:1625567_a_at:421:517; Interrogation_Position=508; Antisense; GTGTGATCAATCTGCCTACGGCTGA
>probe:Drosophila_2:1625567_a_at:165:151; Interrogation_Position=662; Antisense; ACATTGACGTGGAGCTATTGCCCCG
>probe:Drosophila_2:1625567_a_at:288:691; Interrogation_Position=677; Antisense; TATTGCCCCGGGATATCTGTGAGAA
>probe:Drosophila_2:1625567_a_at:271:443; Interrogation_Position=729; Antisense; GATGTGCGCCGGAAATCTGAACAAC
>probe:Drosophila_2:1625567_a_at:428:409; Interrogation_Position=760; Antisense; GACGAGAATCCCTGTGCCGGTGACA
>probe:Drosophila_2:1625567_a_at:220:563; Interrogation_Position=787; Antisense; GGAAGCCCACTGATTTTCAACGAAA
>probe:Drosophila_2:1625567_a_at:540:189; Interrogation_Position=810; Antisense; AACAGTCTTTGGTGTGGTTAGCTAC
>probe:Drosophila_2:1625567_a_at:409:545; Interrogation_Position=847; Antisense; GGATCTAAAACTTTGCCCTCCATTT
>probe:Drosophila_2:1625567_a_at:483:203; Interrogation_Position=926; Antisense; AAGCGAACCGATTGTGTTACTCTCC
>probe:Drosophila_2:1625567_a_at:579:253; Interrogation_Position=951; Antisense; CAACTATCTATTCACCACCATTGGT

Paste this into a BLAST search page for me
GAAGAAGATCTTTGTCCCAGACAAGAACATTGCGCTGATGATGCTGGCCAGATGCTGGCCAAAAAACTACCCTTGACAATCCGCTTGTGGGTGTGATCAAGTGTGATCAATCTGCCTACGGCTGAACATTGACGTGGAGCTATTGCCCCGTATTGCCCCGGGATATCTGTGAGAAGATGTGCGCCGGAAATCTGAACAACGACGAGAATCCCTGTGCCGGTGACAGGAAGCCCACTGATTTTCAACGAAAAACAGTCTTTGGTGTGGTTAGCTACGGATCTAAAACTTTGCCCTCCATTTAAGCGAACCGATTGTGTTACTCTCCCAACTATCTATTCACCACCATTGGT

Full Affymetrix probeset data:

Annotations for 1625567_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime