Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625569_at:

>probe:Drosophila_2:1625569_at:142:547; Interrogation_Position=2820; Antisense; GGATGCATCTATACTGGGCGCATTT
>probe:Drosophila_2:1625569_at:95:693; Interrogation_Position=2842; Antisense; TTTGCAGTGGATATTCGCACCTCTG
>probe:Drosophila_2:1625569_at:76:603; Interrogation_Position=2865; Antisense; TGTTTGCCAGAGTGATTGCTCCGGT
>probe:Drosophila_2:1625569_at:386:5; Interrogation_Position=2879; Antisense; ATTGCTCCGGTCATGGGTCGTGTAA
>probe:Drosophila_2:1625569_at:562:493; Interrogation_Position=2900; Antisense; GTAATCCCATTACCAGAGCTTGCAT
>probe:Drosophila_2:1625569_at:199:683; Interrogation_Position=2924; Antisense; TATGCGAGGCGTTCTGGATGCCATC
>probe:Drosophila_2:1625569_at:377:41; Interrogation_Position=2946; Antisense; ATCGGCTGGCTACTTCTTTAATAAC
>probe:Drosophila_2:1625569_at:377:77; Interrogation_Position=2972; Antisense; AGGAGGCCAATTGCGACTGGTCCAT
>probe:Drosophila_2:1625569_at:271:573; Interrogation_Position=3025; Antisense; GGCTGCCTCTTGCTATCTGGAGTAT
>probe:Drosophila_2:1625569_at:134:675; Interrogation_Position=3059; Antisense; TAGCCTGTGCCTGCAGACAATCGAA
>probe:Drosophila_2:1625569_at:298:183; Interrogation_Position=3083; Antisense; AAAAGCCGCGTCTTCGTCAGAAAGT
>probe:Drosophila_2:1625569_at:482:103; Interrogation_Position=3185; Antisense; AGACGGATTCCGATGTCCTTTTTGA
>probe:Drosophila_2:1625569_at:359:537; Interrogation_Position=3229; Antisense; GGTCTGGGCAAGCACAAGTCGCACA
>probe:Drosophila_2:1625569_at:154:503; Interrogation_Position=3246; Antisense; GTCGCACAATTCTCACAGTCATGGA

Paste this into a BLAST search page for me
GGATGCATCTATACTGGGCGCATTTTTTGCAGTGGATATTCGCACCTCTGTGTTTGCCAGAGTGATTGCTCCGGTATTGCTCCGGTCATGGGTCGTGTAAGTAATCCCATTACCAGAGCTTGCATTATGCGAGGCGTTCTGGATGCCATCATCGGCTGGCTACTTCTTTAATAACAGGAGGCCAATTGCGACTGGTCCATGGCTGCCTCTTGCTATCTGGAGTATTAGCCTGTGCCTGCAGACAATCGAAAAAAGCCGCGTCTTCGTCAGAAAGTAGACGGATTCCGATGTCCTTTTTGAGGTCTGGGCAAGCACAAGTCGCACAGTCGCACAATTCTCACAGTCATGGA

Full Affymetrix probeset data:

Annotations for 1625569_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime