FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625570_at:

>probe:Drosophila_2:1625570_at:530:683; Interrogation_Position=109; Antisense; TATGCGGCTCCCAAGTTGCTTGCTG
>probe:Drosophila_2:1625570_at:363:59; Interrogation_Position=13; Antisense; ATGATTGCCCAGACTCTGTTCGTTT
>probe:Drosophila_2:1625570_at:84:223; Interrogation_Position=247; Antisense; AAGGTGGCTGTTGCCGAGCCCTACG
>probe:Drosophila_2:1625570_at:32:147; Interrogation_Position=25; Antisense; ACTCTGTTCGTTTTGGGACTGATCC
>probe:Drosophila_2:1625570_at:443:347; Interrogation_Position=282; Antisense; GCAGTACAGCTTCTCGTACGGAGTA
>probe:Drosophila_2:1625570_at:213:431; Interrogation_Position=302; Antisense; GAGTAACCGATCATCACACCGGTGA
>probe:Drosophila_2:1625570_at:252:157; Interrogation_Position=317; Antisense; ACACCGGTGACTCCAAGCAGCAGGA
>probe:Drosophila_2:1625570_at:86:95; Interrogation_Position=344; Antisense; AGACCCTGGTCAACGGAGTCGTCCA
>probe:Drosophila_2:1625570_at:719:581; Interrogation_Position=383; Antisense; TGGCCGAACCCGATGGCACTATTCG
>probe:Drosophila_2:1625570_at:452:157; Interrogation_Position=419; Antisense; ACACCGCCGACAAGGTCAACGGATT
>probe:Drosophila_2:1625570_at:355:471; Interrogation_Position=514; Antisense; GTTCCCGCCATCACCAAGATTGGAT
>probe:Drosophila_2:1625570_at:626:251; Interrogation_Position=528; Antisense; CAAGATTGGATACGCTTCGGCGCCT
>probe:Drosophila_2:1625570_at:673:495; Interrogation_Position=554; Antisense; GTCTGAGTCTGGGTGGATACCACTA
>probe:Drosophila_2:1625570_at:683:269; Interrogation_Position=72; Antisense; CATTGATCCCTATGGACTTTCGGCC

Paste this into a BLAST search page for me
TATGCGGCTCCCAAGTTGCTTGCTGATGATTGCCCAGACTCTGTTCGTTTAAGGTGGCTGTTGCCGAGCCCTACGACTCTGTTCGTTTTGGGACTGATCCGCAGTACAGCTTCTCGTACGGAGTAGAGTAACCGATCATCACACCGGTGAACACCGGTGACTCCAAGCAGCAGGAAGACCCTGGTCAACGGAGTCGTCCATGGCCGAACCCGATGGCACTATTCGACACCGCCGACAAGGTCAACGGATTGTTCCCGCCATCACCAAGATTGGATCAAGATTGGATACGCTTCGGCGCCTGTCTGAGTCTGGGTGGATACCACTACATTGATCCCTATGGACTTTCGGCC

Full Affymetrix probeset data:

Annotations for 1625570_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720