Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625572_s_at:

>probe:Drosophila_2:1625572_s_at:483:613; Interrogation_Position=105; Antisense; TGAAGAGCCTGACCAAGCGTCCCAG
>probe:Drosophila_2:1625572_s_at:577:503; Interrogation_Position=123; Antisense; GTCCCAGTGATGACGAGTTCCTGCA
>probe:Drosophila_2:1625572_s_at:457:117; Interrogation_Position=147; Antisense; AGCTGTACGCCCTGTTCAAGCAGGC
>probe:Drosophila_2:1625572_s_at:74:651; Interrogation_Position=162; Antisense; TCAAGCAGGCCAGCGTTGGTGACAA
>probe:Drosophila_2:1625572_s_at:619:511; Interrogation_Position=180; Antisense; GTGACAACGACACCGCCAAGCCGGG
>probe:Drosophila_2:1625572_s_at:89:251; Interrogation_Position=196; Antisense; CAAGCCGGGTCTCCTGGACCTGAAG
>probe:Drosophila_2:1625572_s_at:596:625; Interrogation_Position=207; Antisense; TCCTGGACCTGAAGGGCAAGGCCAA
>probe:Drosophila_2:1625572_s_at:510:115; Interrogation_Position=279; Antisense; AGCAGGAGTACATCACCTTTGTGGA
>probe:Drosophila_2:1625572_s_at:413:89; Interrogation_Position=318; Antisense; AGTATGCCTAAAAACCCAATCCCAG
>probe:Drosophila_2:1625572_s_at:470:249; Interrogation_Position=334; Antisense; CAATCCCAGCAATTAGCGATCTTAA
>probe:Drosophila_2:1625572_s_at:536:327; Interrogation_Position=349; Antisense; GCGATCTTAAACCAGCTAGAGACTA
>probe:Drosophila_2:1625572_s_at:164:599; Interrogation_Position=375; Antisense; TGTAATGTTACCTTTAATGCGGAAT
>probe:Drosophila_2:1625572_s_at:361:235; Interrogation_Position=55; Antisense; AATCTAACCCAGAATGGTTTCCGAG
>probe:Drosophila_2:1625572_s_at:182:61; Interrogation_Position=68; Antisense; ATGGTTTCCGAGCAATTCAACGCCG

Paste this into a BLAST search page for me
TGAAGAGCCTGACCAAGCGTCCCAGGTCCCAGTGATGACGAGTTCCTGCAAGCTGTACGCCCTGTTCAAGCAGGCTCAAGCAGGCCAGCGTTGGTGACAAGTGACAACGACACCGCCAAGCCGGGCAAGCCGGGTCTCCTGGACCTGAAGTCCTGGACCTGAAGGGCAAGGCCAAAGCAGGAGTACATCACCTTTGTGGAAGTATGCCTAAAAACCCAATCCCAGCAATCCCAGCAATTAGCGATCTTAAGCGATCTTAAACCAGCTAGAGACTATGTAATGTTACCTTTAATGCGGAATAATCTAACCCAGAATGGTTTCCGAGATGGTTTCCGAGCAATTCAACGCCG

Full Affymetrix probeset data:

Annotations for 1625572_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime