FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625573_at:

>probe:Drosophila_2:1625573_at:277:191; Interrogation_Position=118; Antisense; AACATAGCCATCGATCAGTTGGACA
>probe:Drosophila_2:1625573_at:346:157; Interrogation_Position=15; Antisense; ACACCCAGCTGTCCCTATTATATAG
>probe:Drosophila_2:1625573_at:556:693; Interrogation_Position=161; Antisense; TTTCCGACTTCCTAATGTCCTACAA
>probe:Drosophila_2:1625573_at:668:177; Interrogation_Position=187; Antisense; AAACTGTCCGAGACGTGCTTCACAG
>probe:Drosophila_2:1625573_at:698:341; Interrogation_Position=203; Antisense; GCTTCACAGATTGCATACGCGACTT
>probe:Drosophila_2:1625573_at:278:325; Interrogation_Position=221; Antisense; GCGACTTTACAACGCGGGATGTTAA
>probe:Drosophila_2:1625573_at:223:373; Interrogation_Position=258; Antisense; GAAGTGCTCGCTGAACTGCATGGAA
>probe:Drosophila_2:1625573_at:455:375; Interrogation_Position=291; Antisense; GAAGATGAACCAACGCGTCTCGCAG
>probe:Drosophila_2:1625573_at:90:643; Interrogation_Position=308; Antisense; TCTCGCAGCGTTTCCAGGAGTTCCA
>probe:Drosophila_2:1625573_at:684:51; Interrogation_Position=323; Antisense; AGGAGTTCCAGGTTATTGCCCACGA
>probe:Drosophila_2:1625573_at:92:477; Interrogation_Position=334; Antisense; GTTATTGCCCACGAGAACGCACTGG
>probe:Drosophila_2:1625573_at:59:383; Interrogation_Position=348; Antisense; GAACGCACTGGCCATGGCTCAAAAG
>probe:Drosophila_2:1625573_at:96:357; Interrogation_Position=40; Antisense; GCACATTATTATTGGCCCTTTTTCG
>probe:Drosophila_2:1625573_at:97:447; Interrogation_Position=436; Antisense; GATGCATTTTCCTGCATTTGTCAAA

Paste this into a BLAST search page for me
AACATAGCCATCGATCAGTTGGACAACACCCAGCTGTCCCTATTATATAGTTTCCGACTTCCTAATGTCCTACAAAAACTGTCCGAGACGTGCTTCACAGGCTTCACAGATTGCATACGCGACTTGCGACTTTACAACGCGGGATGTTAAGAAGTGCTCGCTGAACTGCATGGAAGAAGATGAACCAACGCGTCTCGCAGTCTCGCAGCGTTTCCAGGAGTTCCAAGGAGTTCCAGGTTATTGCCCACGAGTTATTGCCCACGAGAACGCACTGGGAACGCACTGGCCATGGCTCAAAAGGCACATTATTATTGGCCCTTTTTCGGATGCATTTTCCTGCATTTGTCAAA

Full Affymetrix probeset data:

Annotations for 1625573_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720