Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625574_at:

>probe:Drosophila_2:1625574_at:53:91; Interrogation_Position=4123; Antisense; AGTTTTTCTCGCTCTGTCCAGGGAG
>probe:Drosophila_2:1625574_at:627:347; Interrogation_Position=4147; Antisense; GCAGGCCATTCCGAAGACATATGTG
>probe:Drosophila_2:1625574_at:375:361; Interrogation_Position=4190; Antisense; GAATTCGATTCGTTGTACCAGTTGA
>probe:Drosophila_2:1625574_at:575:487; Interrogation_Position=4204; Antisense; GTACCAGTTGATTGTCCAGGAGCGG
>probe:Drosophila_2:1625574_at:700:669; Interrogation_Position=4238; Antisense; TACGTCTGCGGCGATGTCACAATGG
>probe:Drosophila_2:1625574_at:115:229; Interrogation_Position=4258; Antisense; AATGGCCGAGCATGTGTACCAGACC
>probe:Drosophila_2:1625574_at:224:487; Interrogation_Position=4273; Antisense; GTACCAGACCATCAGGAAGTGCATT
>probe:Drosophila_2:1625574_at:458:401; Interrogation_Position=4333; Antisense; GACATTTTTGCTAACACTGCGGGAC
>probe:Drosophila_2:1625574_at:226:409; Interrogation_Position=4355; Antisense; GACGAAAGTCGCTACCACGAGGACA
>probe:Drosophila_2:1625574_at:583:135; Interrogation_Position=4371; Antisense; ACGAGGACATCTTTGGCATCACGCT
>probe:Drosophila_2:1625574_at:538:623; Interrogation_Position=4395; Antisense; TGCGAACGGCTGAGATACACACAAA
>probe:Drosophila_2:1625574_at:441:157; Interrogation_Position=4413; Antisense; ACACAAAGTCAAGGGCCACGGCCAG
>probe:Drosophila_2:1625574_at:268:371; Interrogation_Position=4443; Antisense; GAATGGCCTCCCAGCCATAAGGATA
>probe:Drosophila_2:1625574_at:153:439; Interrogation_Position=4514; Antisense; GAGGAATACCAAGCACTTGCTCTTT

Paste this into a BLAST search page for me
AGTTTTTCTCGCTCTGTCCAGGGAGGCAGGCCATTCCGAAGACATATGTGGAATTCGATTCGTTGTACCAGTTGAGTACCAGTTGATTGTCCAGGAGCGGTACGTCTGCGGCGATGTCACAATGGAATGGCCGAGCATGTGTACCAGACCGTACCAGACCATCAGGAAGTGCATTGACATTTTTGCTAACACTGCGGGACGACGAAAGTCGCTACCACGAGGACAACGAGGACATCTTTGGCATCACGCTTGCGAACGGCTGAGATACACACAAAACACAAAGTCAAGGGCCACGGCCAGGAATGGCCTCCCAGCCATAAGGATAGAGGAATACCAAGCACTTGCTCTTT

Full Affymetrix probeset data:

Annotations for 1625574_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime