FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625575_at:

>probe:Drosophila_2:1625575_at:184:349; Interrogation_Position=1017; Antisense; GCAGGGCTGTTTCTACAACTTTGTC
>probe:Drosophila_2:1625575_at:109:255; Interrogation_Position=1032; Antisense; CAACTTTGTCTGTGGTGTAATCTTA
>probe:Drosophila_2:1625575_at:420:427; Interrogation_Position=469; Antisense; GAGATCCTCTTCGAAGAACTGCAGC
>probe:Drosophila_2:1625575_at:159:467; Interrogation_Position=522; Antisense; GTTGGATGCACTTACTCTGTTCGAC
>probe:Drosophila_2:1625575_at:92:637; Interrogation_Position=542; Antisense; TCGACGCAGAATCCGCTCACATGAA
>probe:Drosophila_2:1625575_at:597:383; Interrogation_Position=564; Antisense; GAACTCGGTCATCGATGTCATCTGC
>probe:Drosophila_2:1625575_at:617:259; Interrogation_Position=618; Antisense; CACTGGTCCAGATCTGCTGCTTGAG
>probe:Drosophila_2:1625575_at:279:429; Interrogation_Position=640; Antisense; GAGTTTAATGCCAGCTCCAATCGCA
>probe:Drosophila_2:1625575_at:521:451; Interrogation_Position=706; Antisense; GATCTGGGAGTACCGAACGCCTCTG
>probe:Drosophila_2:1625575_at:186:519; Interrogation_Position=835; Antisense; GTGGAACTATCGAAGCCCGGACGCT
>probe:Drosophila_2:1625575_at:89:177; Interrogation_Position=899; Antisense; AAACGGATGCGTCCAATTCACAGCC
>probe:Drosophila_2:1625575_at:565:711; Interrogation_Position=915; Antisense; TTCACAGCCTCGGTCCAAAGTGATT
>probe:Drosophila_2:1625575_at:698:569; Interrogation_Position=971; Antisense; GGCTCAGTCTATTGCCAACTGTTGT
>probe:Drosophila_2:1625575_at:446:195; Interrogation_Position=987; Antisense; AACTGTTGTCACGTTCAAATGGCGG

Paste this into a BLAST search page for me
GCAGGGCTGTTTCTACAACTTTGTCCAACTTTGTCTGTGGTGTAATCTTAGAGATCCTCTTCGAAGAACTGCAGCGTTGGATGCACTTACTCTGTTCGACTCGACGCAGAATCCGCTCACATGAAGAACTCGGTCATCGATGTCATCTGCCACTGGTCCAGATCTGCTGCTTGAGGAGTTTAATGCCAGCTCCAATCGCAGATCTGGGAGTACCGAACGCCTCTGGTGGAACTATCGAAGCCCGGACGCTAAACGGATGCGTCCAATTCACAGCCTTCACAGCCTCGGTCCAAAGTGATTGGCTCAGTCTATTGCCAACTGTTGTAACTGTTGTCACGTTCAAATGGCGG

Full Affymetrix probeset data:

Annotations for 1625575_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720