Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625577_at:

>probe:Drosophila_2:1625577_at:707:147; Interrogation_Position=1210; Antisense; ACTTCGCAGGTAGGATTCGTGTCCG
>probe:Drosophila_2:1625577_at:711:539; Interrogation_Position=1222; Antisense; GGATTCGTGTCCGATAACCGGTCTG
>probe:Drosophila_2:1625577_at:577:453; Interrogation_Position=1234; Antisense; GATAACCGGTCTGCCAATCCTATTC
>probe:Drosophila_2:1625577_at:184:231; Interrogation_Position=1285; Antisense; AATCCACTATCCAGGTCCAACGAGG
>probe:Drosophila_2:1625577_at:315:513; Interrogation_Position=1396; Antisense; GTGATCAACACGATGGTCATGCTGA
>probe:Drosophila_2:1625577_at:227:271; Interrogation_Position=1413; Antisense; CATGCTGATCGGACCGGTGGTGTAC
>probe:Drosophila_2:1625577_at:585:137; Interrogation_Position=1436; Antisense; ACGAGTATGTCGACTACACGGCCAT
>probe:Drosophila_2:1625577_at:556:691; Interrogation_Position=1546; Antisense; TTTGTCGACACCTTCAAGGGTCTGC
>probe:Drosophila_2:1625577_at:65:335; Interrogation_Position=1612; Antisense; GCTGCTGGTGGAGGACTCTCCGCCA
>probe:Drosophila_2:1625577_at:494:505; Interrogation_Position=1670; Antisense; GTGCCAACACCAACATTAGTCTCAA
>probe:Drosophila_2:1625577_at:688:231; Interrogation_Position=1693; Antisense; AATCCCGGCCTAGCCATGGGTATGG
>probe:Drosophila_2:1625577_at:706:329; Interrogation_Position=1725; Antisense; GCGGAGTCGCTCACGCCACGAGTTT
>probe:Drosophila_2:1625577_at:12:429; Interrogation_Position=1744; Antisense; GAGTTTCTCAATGCGGTGGTGACCA
>probe:Drosophila_2:1625577_at:200:517; Interrogation_Position=1759; Antisense; GTGGTGACCACCAATAGTGCCGCCG

Paste this into a BLAST search page for me
ACTTCGCAGGTAGGATTCGTGTCCGGGATTCGTGTCCGATAACCGGTCTGGATAACCGGTCTGCCAATCCTATTCAATCCACTATCCAGGTCCAACGAGGGTGATCAACACGATGGTCATGCTGACATGCTGATCGGACCGGTGGTGTACACGAGTATGTCGACTACACGGCCATTTTGTCGACACCTTCAAGGGTCTGCGCTGCTGGTGGAGGACTCTCCGCCAGTGCCAACACCAACATTAGTCTCAAAATCCCGGCCTAGCCATGGGTATGGGCGGAGTCGCTCACGCCACGAGTTTGAGTTTCTCAATGCGGTGGTGACCAGTGGTGACCACCAATAGTGCCGCCG

Full Affymetrix probeset data:

Annotations for 1625577_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime