FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625578_at:

>probe:Drosophila_2:1625578_at:82:481; Interrogation_Position=2013; Antisense; GTATCGGCTTTCAGCACTTGGGAGA
>probe:Drosophila_2:1625578_at:387:161; Interrogation_Position=2047; Antisense; ACAAGATCGTGTTCGACCCGCGGTA
>probe:Drosophila_2:1625578_at:263:331; Interrogation_Position=2066; Antisense; GCGGTATCTTCTGCTGACTTCGAAG
>probe:Drosophila_2:1625578_at:309:547; Interrogation_Position=2177; Antisense; GGAGGACTTCCGCAGCCTAATGGAA
>probe:Drosophila_2:1625578_at:721:379; Interrogation_Position=2202; Antisense; GAAGCCAGGCTGCACGGAAAATCCT
>probe:Drosophila_2:1625578_at:505:561; Interrogation_Position=2217; Antisense; GGAAAATCCTCATTCTCGGAGTTTA
>probe:Drosophila_2:1625578_at:196:75; Interrogation_Position=2257; Antisense; AGGATGAACGGTATCGGGCCATCGA
>probe:Drosophila_2:1625578_at:91:579; Interrogation_Position=2273; Antisense; GGCCATCGAGAAGGTTCGCGAACGA
>probe:Drosophila_2:1625578_at:112:425; Interrogation_Position=2296; Antisense; GAGAGAGTCTCTTCAACGAGTACAT
>probe:Drosophila_2:1625578_at:346:213; Interrogation_Position=2365; Antisense; AAGAGCAGCCACTAGCTAGCAGGTT
>probe:Drosophila_2:1625578_at:586:115; Interrogation_Position=2436; Antisense; AGCATCGAGAACCACCTGTACAACA
>probe:Drosophila_2:1625578_at:174:599; Interrogation_Position=2452; Antisense; TGTACAACACTCTCGACGGTCTATT
>probe:Drosophila_2:1625578_at:27:605; Interrogation_Position=2505; Antisense; TGATCTACTTGACCACGCACATGTT
>probe:Drosophila_2:1625578_at:666:413; Interrogation_Position=2515; Antisense; GACCACGCACATGTTTGCAATCTGT

Paste this into a BLAST search page for me
GTATCGGCTTTCAGCACTTGGGAGAACAAGATCGTGTTCGACCCGCGGTAGCGGTATCTTCTGCTGACTTCGAAGGGAGGACTTCCGCAGCCTAATGGAAGAAGCCAGGCTGCACGGAAAATCCTGGAAAATCCTCATTCTCGGAGTTTAAGGATGAACGGTATCGGGCCATCGAGGCCATCGAGAAGGTTCGCGAACGAGAGAGAGTCTCTTCAACGAGTACATAAGAGCAGCCACTAGCTAGCAGGTTAGCATCGAGAACCACCTGTACAACATGTACAACACTCTCGACGGTCTATTTGATCTACTTGACCACGCACATGTTGACCACGCACATGTTTGCAATCTGT

Full Affymetrix probeset data:

Annotations for 1625578_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720