Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625581_at:

>probe:Drosophila_2:1625581_at:708:357; Interrogation_Position=8076; Antisense; GCAAAGCAGCAAATCACAGACACAA
>probe:Drosophila_2:1625581_at:389:397; Interrogation_Position=8094; Antisense; GACACAACAAACAACGCACTGGGCT
>probe:Drosophila_2:1625581_at:498:199; Interrogation_Position=8106; Antisense; AACGCACTGGGCTAAATCCAAAAAG
>probe:Drosophila_2:1625581_at:285:199; Interrogation_Position=8136; Antisense; AACGAAGCATAGTTGAACAGCGAAA
>probe:Drosophila_2:1625581_at:164:659; Interrogation_Position=8191; Antisense; TTAACAAACCTATAACATACCGCAG
>probe:Drosophila_2:1625581_at:721:269; Interrogation_Position=8206; Antisense; CATACCGCAGAATACAATTGTTTAG
>probe:Drosophila_2:1625581_at:215:537; Interrogation_Position=8274; Antisense; GGTCAGAGTTATTCAAAGTATCATT
>probe:Drosophila_2:1625581_at:493:239; Interrogation_Position=8332; Antisense; AATACAATCCACAGAGATACACACA
>probe:Drosophila_2:1625581_at:527:455; Interrogation_Position=8347; Antisense; GATACACACACAACACGAAATGCAT
>probe:Drosophila_2:1625581_at:220:31; Interrogation_Position=8415; Antisense; ATACACACATGATACCTATGCCTAA
>probe:Drosophila_2:1625581_at:545:387; Interrogation_Position=8494; Antisense; GAAAAGGTTGCGATGAATTATTGAC
>probe:Drosophila_2:1625581_at:474:161; Interrogation_Position=8570; Antisense; AACAACTTTTTGAGCGAAGCGACGA
>probe:Drosophila_2:1625581_at:691:293; Interrogation_Position=8584; Antisense; CGAAGCGACGAATAACGAAGCATAT
>probe:Drosophila_2:1625581_at:182:151; Interrogation_Position=8609; Antisense; ACATACATATATAACTCTGAATCTG

Paste this into a BLAST search page for me
GCAAAGCAGCAAATCACAGACACAAGACACAACAAACAACGCACTGGGCTAACGCACTGGGCTAAATCCAAAAAGAACGAAGCATAGTTGAACAGCGAAATTAACAAACCTATAACATACCGCAGCATACCGCAGAATACAATTGTTTAGGGTCAGAGTTATTCAAAGTATCATTAATACAATCCACAGAGATACACACAGATACACACACAACACGAAATGCATATACACACATGATACCTATGCCTAAGAAAAGGTTGCGATGAATTATTGACAACAACTTTTTGAGCGAAGCGACGACGAAGCGACGAATAACGAAGCATATACATACATATATAACTCTGAATCTG

Full Affymetrix probeset data:

Annotations for 1625581_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime