FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625582_at:

>probe:Drosophila_2:1625582_at:431:59; Interrogation_Position=1000; Antisense; ATGTTCAACGAAATGCTGCGTCCCG
>probe:Drosophila_2:1625582_at:636:583; Interrogation_Position=1049; Antisense; TGGACACCTTGGCACGACGTTTCAA
>probe:Drosophila_2:1625582_at:121:479; Interrogation_Position=1067; Antisense; GTTTCAATACCCTGTACGCTTTGGA
>probe:Drosophila_2:1625582_at:186:507; Interrogation_Position=1111; Antisense; GTGCGCCTCATTGTGGAGAGCATCT
>probe:Drosophila_2:1625582_at:148:449; Interrogation_Position=1183; Antisense; GATCCTGGGCATAGGTCCTTTAGTT
>probe:Drosophila_2:1625582_at:137:469; Interrogation_Position=1270; Antisense; GTTGAGCTCCTTGACGAACTGGTGG
>probe:Drosophila_2:1625582_at:154:297; Interrogation_Position=731; Antisense; CGCTGAGGCGACTGGACGTATTTCT
>probe:Drosophila_2:1625582_at:588:481; Interrogation_Position=748; Antisense; GTATTTCTGGAGTCGGAGCACGCCG
>probe:Drosophila_2:1625582_at:341:507; Interrogation_Position=775; Antisense; GTGCCTGTGGTGCTCCAGTTAATAT
>probe:Drosophila_2:1625582_at:427:215; Interrogation_Position=814; Antisense; AAGATCGTCGACTGCTACGTTGAGC
>probe:Drosophila_2:1625582_at:723:579; Interrogation_Position=839; Antisense; TGGCCATGGAGTACAGCTTCGAGGA
>probe:Drosophila_2:1625582_at:334:105; Interrogation_Position=878; Antisense; AGACATTGGCCCTGAATCCGAGGAC
>probe:Drosophila_2:1625582_at:293:287; Interrogation_Position=911; Antisense; CGGGCAGCTATCTCATCGGAAACGA
>probe:Drosophila_2:1625582_at:654:197; Interrogation_Position=931; Antisense; AACGATGTGTTTCCTCTCAAATCCT

Paste this into a BLAST search page for me
ATGTTCAACGAAATGCTGCGTCCCGTGGACACCTTGGCACGACGTTTCAAGTTTCAATACCCTGTACGCTTTGGAGTGCGCCTCATTGTGGAGAGCATCTGATCCTGGGCATAGGTCCTTTAGTTGTTGAGCTCCTTGACGAACTGGTGGCGCTGAGGCGACTGGACGTATTTCTGTATTTCTGGAGTCGGAGCACGCCGGTGCCTGTGGTGCTCCAGTTAATATAAGATCGTCGACTGCTACGTTGAGCTGGCCATGGAGTACAGCTTCGAGGAAGACATTGGCCCTGAATCCGAGGACCGGGCAGCTATCTCATCGGAAACGAAACGATGTGTTTCCTCTCAAATCCT

Full Affymetrix probeset data:

Annotations for 1625582_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720