Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625583_at:

>probe:Drosophila_2:1625583_at:372:33; Interrogation_Position=284; Antisense; ATCAATCTCGATCAGCATTTCACCG
>probe:Drosophila_2:1625583_at:73:345; Interrogation_Position=298; Antisense; GCATTTCACCGAGTGCTGGAATACA
>probe:Drosophila_2:1625583_at:209:333; Interrogation_Position=312; Antisense; GCTGGAATACAAGCCCATTGCGAAA
>probe:Drosophila_2:1625583_at:619:321; Interrogation_Position=324; Antisense; GCCCATTGCGAAACTTTGACTTCAT
>probe:Drosophila_2:1625583_at:144:35; Interrogation_Position=347; Antisense; ATCATCTCCCTTCTGAGCGTTATTT
>probe:Drosophila_2:1625583_at:196:609; Interrogation_Position=360; Antisense; TGAGCGTTATTTCCCTAAGTGTTGT
>probe:Drosophila_2:1625583_at:366:221; Interrogation_Position=376; Antisense; AAGTGTTGTTAAGATGGCCGCCATT
>probe:Drosophila_2:1625583_at:176:69; Interrogation_Position=389; Antisense; ATGGCCGCCATTCCACAAGGTGCAT
>probe:Drosophila_2:1625583_at:170:81; Interrogation_Position=406; Antisense; AGGTGCATTCGCAGCCTGCAAGATT
>probe:Drosophila_2:1625583_at:54:617; Interrogation_Position=422; Antisense; TGCAAGATTCGCGAGCAATTCAACG
>probe:Drosophila_2:1625583_at:313:199; Interrogation_Position=443; Antisense; AACGAACGTGAGCTGATCATCGCCC
>probe:Drosophila_2:1625583_at:594:333; Interrogation_Position=479; Antisense; GCTGCCGCAGATAAGGGTTCCGTTG
>probe:Drosophila_2:1625583_at:548:397; Interrogation_Position=554; Antisense; GACAAGCTGATGAACTCCATCTGGG
>probe:Drosophila_2:1625583_at:644:45; Interrogation_Position=697; Antisense; ATCCCCACCAGGATGTTGGTCAAAA

Paste this into a BLAST search page for me
ATCAATCTCGATCAGCATTTCACCGGCATTTCACCGAGTGCTGGAATACAGCTGGAATACAAGCCCATTGCGAAAGCCCATTGCGAAACTTTGACTTCATATCATCTCCCTTCTGAGCGTTATTTTGAGCGTTATTTCCCTAAGTGTTGTAAGTGTTGTTAAGATGGCCGCCATTATGGCCGCCATTCCACAAGGTGCATAGGTGCATTCGCAGCCTGCAAGATTTGCAAGATTCGCGAGCAATTCAACGAACGAACGTGAGCTGATCATCGCCCGCTGCCGCAGATAAGGGTTCCGTTGGACAAGCTGATGAACTCCATCTGGGATCCCCACCAGGATGTTGGTCAAAA

Full Affymetrix probeset data:

Annotations for 1625583_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime