FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625584_at:

>probe:Drosophila_2:1625584_at:655:293; Interrogation_Position=1861; Antisense; CGATGCGATATGTCAGTCACCGAAA
>probe:Drosophila_2:1625584_at:404:181; Interrogation_Position=1883; Antisense; AAAAGCTAAACTGCCGTTCGTGCCG
>probe:Drosophila_2:1625584_at:429:329; Interrogation_Position=1970; Antisense; GCGGAGTAACTTCCACTTCGTGATT
>probe:Drosophila_2:1625584_at:707:349; Interrogation_Position=2010; Antisense; GCAGTCTGAATCCAGTCTCAATCGT
>probe:Drosophila_2:1625584_at:59:89; Interrogation_Position=2023; Antisense; AGTCTCAATCGTAGCTGTTCTCCAA
>probe:Drosophila_2:1625584_at:339:603; Interrogation_Position=2038; Antisense; TGTTCTCCAACTGCCTTAATGTCGA
>probe:Drosophila_2:1625584_at:123:359; Interrogation_Position=2115; Antisense; GCAAACTTCGCATGTGAACCCAATC
>probe:Drosophila_2:1625584_at:228:511; Interrogation_Position=2128; Antisense; GTGAACCCAATCGATAGCAGCTAAG
>probe:Drosophila_2:1625584_at:186:521; Interrogation_Position=2187; Antisense; GTGGAAACTGTTTCTCCGGATCGAA
>probe:Drosophila_2:1625584_at:464:715; Interrogation_Position=2198; Antisense; TTCTCCGGATCGAAGTGCATCTCAT
>probe:Drosophila_2:1625584_at:163:347; Interrogation_Position=2214; Antisense; GCATCTCATAAAGTTTCTGTGGGCA
>probe:Drosophila_2:1625584_at:343:517; Interrogation_Position=2232; Antisense; GTGGGCAAACACGAGGCTTTCAATC
>probe:Drosophila_2:1625584_at:433:95; Interrogation_Position=2259; Antisense; AGATATTTGTATCAGCTGTCGCTAT
>probe:Drosophila_2:1625584_at:96:121; Interrogation_Position=2272; Antisense; AGCTGTCGCTATAAGTCCCGAGAAA

Paste this into a BLAST search page for me
CGATGCGATATGTCAGTCACCGAAAAAAAGCTAAACTGCCGTTCGTGCCGGCGGAGTAACTTCCACTTCGTGATTGCAGTCTGAATCCAGTCTCAATCGTAGTCTCAATCGTAGCTGTTCTCCAATGTTCTCCAACTGCCTTAATGTCGAGCAAACTTCGCATGTGAACCCAATCGTGAACCCAATCGATAGCAGCTAAGGTGGAAACTGTTTCTCCGGATCGAATTCTCCGGATCGAAGTGCATCTCATGCATCTCATAAAGTTTCTGTGGGCAGTGGGCAAACACGAGGCTTTCAATCAGATATTTGTATCAGCTGTCGCTATAGCTGTCGCTATAAGTCCCGAGAAA

Full Affymetrix probeset data:

Annotations for 1625584_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720