FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625585_at:

>probe:Drosophila_2:1625585_at:392:607; Interrogation_Position=1019; Antisense; TGAGTGCATAGCGATCCTAGCGGAT
>probe:Drosophila_2:1625585_at:268:675; Interrogation_Position=1036; Antisense; TAGCGGATCGCATCGTTACCATAAT
>probe:Drosophila_2:1625585_at:723:75; Interrogation_Position=1078; Antisense; AGGAGCTGCAACCTTCTGAGATTGC
>probe:Drosophila_2:1625585_at:482:677; Interrogation_Position=1116; Antisense; TAGATGCTATTTTCGCGGTGGCTGT
>probe:Drosophila_2:1625585_at:150:317; Interrogation_Position=1231; Antisense; TCCACCAGTCGCTCTTTAAAACGTT
>probe:Drosophila_2:1625585_at:19:487; Interrogation_Position=1259; Antisense; GTACCTCCGGGATATCGTGTTGCTC
>probe:Drosophila_2:1625585_at:669:587; Interrogation_Position=1293; Antisense; TGTACCCGATAACCCCGAGAAGGAG
>probe:Drosophila_2:1625585_at:129:63; Interrogation_Position=1335; Antisense; ATGTGCGTTCAATCCTTGTAGCCAA
>probe:Drosophila_2:1625585_at:117:441; Interrogation_Position=817; Antisense; GATGGAATGAGATCCGCCGACATGA
>probe:Drosophila_2:1625585_at:517:277; Interrogation_Position=896; Antisense; CTACTGCATGCAAATCGTTCGTCGA
>probe:Drosophila_2:1625585_at:494:471; Interrogation_Position=912; Antisense; GTTCGTCGATTCTTTTTCAACAGGA
>probe:Drosophila_2:1625585_at:338:47; Interrogation_Position=965; Antisense; ATCCTATATGGACCGGGCACACTAT
>probe:Drosophila_2:1625585_at:728:257; Interrogation_Position=982; Antisense; CACACTATGCTTCCTTTATTCTGGG
>probe:Drosophila_2:1625585_at:427:11; Interrogation_Position=999; Antisense; ATTCTGGGACCAGCCACTGATGAGT

Paste this into a BLAST search page for me
TGAGTGCATAGCGATCCTAGCGGATTAGCGGATCGCATCGTTACCATAATAGGAGCTGCAACCTTCTGAGATTGCTAGATGCTATTTTCGCGGTGGCTGTTCCACCAGTCGCTCTTTAAAACGTTGTACCTCCGGGATATCGTGTTGCTCTGTACCCGATAACCCCGAGAAGGAGATGTGCGTTCAATCCTTGTAGCCAAGATGGAATGAGATCCGCCGACATGACTACTGCATGCAAATCGTTCGTCGAGTTCGTCGATTCTTTTTCAACAGGAATCCTATATGGACCGGGCACACTATCACACTATGCTTCCTTTATTCTGGGATTCTGGGACCAGCCACTGATGAGT

Full Affymetrix probeset data:

Annotations for 1625585_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720