Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625587_at:

>probe:Drosophila_2:1625587_at:332:463; Interrogation_Position=1014; Antisense; GATTCTTTGTGGATCATCACTTCCC
>probe:Drosophila_2:1625587_at:658:173; Interrogation_Position=1071; Antisense; AAAGCGGTTACTTTCACATCCAGGC
>probe:Drosophila_2:1625587_at:378:455; Interrogation_Position=1106; Antisense; GATACGATTGGAGCGGCTCTGACCT
>probe:Drosophila_2:1625587_at:290:727; Interrogation_Position=1145; Antisense; TTGGCCTCCTATATCCTCGAGAAAT
>probe:Drosophila_2:1625587_at:305:305; Interrogation_Position=1192; Antisense; CCTGAAGCAGGACTTTGGCGCCATA
>probe:Drosophila_2:1625587_at:612:729; Interrogation_Position=1206; Antisense; TTGGCGCCATAGTCACTGTCTTCGG
>probe:Drosophila_2:1625587_at:99:203; Interrogation_Position=1250; Antisense; AACCTGATGGTCTACTATCTGACGA
>probe:Drosophila_2:1625587_at:346:117; Interrogation_Position=1288; Antisense; AGCGGCTCGTTTCTACCTGGAGAAC
>probe:Drosophila_2:1625587_at:484:499; Interrogation_Position=1315; Antisense; GTCCAAGACGTACAGGGATCTCCAG
>probe:Drosophila_2:1625587_at:530:543; Interrogation_Position=1330; Antisense; GGATCTCCAGCTGGATCGTGTGCAG
>probe:Drosophila_2:1625587_at:294:471; Interrogation_Position=1387; Antisense; GTTCGATCTGGCCTCGGTGACTGAC
>probe:Drosophila_2:1625587_at:559:551; Interrogation_Position=1486; Antisense; GGAGATGCCGGCCATGTTGTTCAAT
>probe:Drosophila_2:1625587_at:469:463; Interrogation_Position=1501; Antisense; GTTGTTCAATGATTTTACCGCCTTT
>probe:Drosophila_2:1625587_at:24:551; Interrogation_Position=994; Antisense; GGAGAAGTACTTGCCGTCCAGATTC

Paste this into a BLAST search page for me
GATTCTTTGTGGATCATCACTTCCCAAAGCGGTTACTTTCACATCCAGGCGATACGATTGGAGCGGCTCTGACCTTTGGCCTCCTATATCCTCGAGAAATCCTGAAGCAGGACTTTGGCGCCATATTGGCGCCATAGTCACTGTCTTCGGAACCTGATGGTCTACTATCTGACGAAGCGGCTCGTTTCTACCTGGAGAACGTCCAAGACGTACAGGGATCTCCAGGGATCTCCAGCTGGATCGTGTGCAGGTTCGATCTGGCCTCGGTGACTGACGGAGATGCCGGCCATGTTGTTCAATGTTGTTCAATGATTTTACCGCCTTTGGAGAAGTACTTGCCGTCCAGATTC

Full Affymetrix probeset data:

Annotations for 1625587_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime