FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625589_at:

>probe:Drosophila_2:1625589_at:185:95; Interrogation_Position=1597; Antisense; AGTTGACCGAATTCGAGCGAGTTCA
>probe:Drosophila_2:1625589_at:59:673; Interrogation_Position=1705; Antisense; TACGCAGTGCGCAGATATCCACGGA
>probe:Drosophila_2:1625589_at:273:399; Interrogation_Position=1728; Antisense; GACAGTGAATCTCATCCGACAACGA
>probe:Drosophila_2:1625589_at:68:399; Interrogation_Position=1751; Antisense; GACACCAGGTCACAGAATCTCAAGT
>probe:Drosophila_2:1625589_at:680:37; Interrogation_Position=1767; Antisense; ATCTCAAGTTCATCGCTGGAGGCAT
>probe:Drosophila_2:1625589_at:536:587; Interrogation_Position=1783; Antisense; TGGAGGCATTTTCAACTGGCGACAA
>probe:Drosophila_2:1625589_at:117:709; Interrogation_Position=1864; Antisense; TTAAGTTCTTGACCAGTCGCGAGGT
>probe:Drosophila_2:1625589_at:453:435; Interrogation_Position=1884; Antisense; GAGGTGGAAGCTCGCCATCTTGTTC
>probe:Drosophila_2:1625589_at:493:505; Interrogation_Position=1909; Antisense; GTGCCGTATCCACATTACTTCAATT
>probe:Drosophila_2:1625589_at:32:389; Interrogation_Position=1947; Antisense; GAAAAGCTGCTACACGACACATTGA
>probe:Drosophila_2:1625589_at:336:487; Interrogation_Position=2010; Antisense; GTAGCCACAGCAATACATCACATTT
>probe:Drosophila_2:1625589_at:15:677; Interrogation_Position=2048; Antisense; TAGTCAATTCATAACGTTCGTGTAA
>probe:Drosophila_2:1625589_at:459:27; Interrogation_Position=2080; Antisense; ATACCAATTGCATACGCAGCACTGT
>probe:Drosophila_2:1625589_at:158:353; Interrogation_Position=2095; Antisense; GCAGCACTGTGTTATTTTGTTTACC

Paste this into a BLAST search page for me
AGTTGACCGAATTCGAGCGAGTTCATACGCAGTGCGCAGATATCCACGGAGACAGTGAATCTCATCCGACAACGAGACACCAGGTCACAGAATCTCAAGTATCTCAAGTTCATCGCTGGAGGCATTGGAGGCATTTTCAACTGGCGACAATTAAGTTCTTGACCAGTCGCGAGGTGAGGTGGAAGCTCGCCATCTTGTTCGTGCCGTATCCACATTACTTCAATTGAAAAGCTGCTACACGACACATTGAGTAGCCACAGCAATACATCACATTTTAGTCAATTCATAACGTTCGTGTAAATACCAATTGCATACGCAGCACTGTGCAGCACTGTGTTATTTTGTTTACC

Full Affymetrix probeset data:

Annotations for 1625589_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720