FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625591_at:

>probe:Drosophila_2:1625591_at:306:17; Interrogation_Position=1029; Antisense; ATTTATGCTGTTTGCCGAGAGTCTG
>probe:Drosophila_2:1625591_at:485:81; Interrogation_Position=1057; Antisense; AGGGATCAGGCAACGGGCTTCTTAT
>probe:Drosophila_2:1625591_at:495:283; Interrogation_Position=1100; Antisense; CTGAATGGCAGCAGTTGACCCGATT
>probe:Drosophila_2:1625591_at:652:331; Interrogation_Position=1130; Antisense; GCTGCCCAAAGGACACCGGAGTTAT
>probe:Drosophila_2:1625591_at:72:641; Interrogation_Position=1186; Antisense; TCGGCGGAGTTCTTGGCCCAAAGAC
>probe:Drosophila_2:1625591_at:310:401; Interrogation_Position=1208; Antisense; GACAGGGTGTCTATTATTTCCAAAC
>probe:Drosophila_2:1625591_at:231:127; Interrogation_Position=1241; Antisense; AGCCACCCTATGTTTTAGCGCAAAA
>probe:Drosophila_2:1625591_at:208:329; Interrogation_Position=718; Antisense; GCGGGAATGCGTTTCGAGGATCTTC
>probe:Drosophila_2:1625591_at:648:435; Interrogation_Position=733; Antisense; GAGGATCTTCAGCTCGTCGGATTCA
>probe:Drosophila_2:1625591_at:719:291; Interrogation_Position=747; Antisense; CGTCGGATTCAGCATGGGCGCACAT
>probe:Drosophila_2:1625591_at:3:359; Interrogation_Position=788; Antisense; GCAAACATTTGCAGACCGGTCGCCT
>probe:Drosophila_2:1625591_at:242:611; Interrogation_Position=878; Antisense; TGACCGCCGAGGATGCCGACTATGT
>probe:Drosophila_2:1625591_at:453:681; Interrogation_Position=931; Antisense; TATGGATTTGATCGACCCGTGGGTC
>probe:Drosophila_2:1625591_at:60:357; Interrogation_Position=987; Antisense; GCAACCAGGTTGCTTTTGGCATGAA

Paste this into a BLAST search page for me
ATTTATGCTGTTTGCCGAGAGTCTGAGGGATCAGGCAACGGGCTTCTTATCTGAATGGCAGCAGTTGACCCGATTGCTGCCCAAAGGACACCGGAGTTATTCGGCGGAGTTCTTGGCCCAAAGACGACAGGGTGTCTATTATTTCCAAACAGCCACCCTATGTTTTAGCGCAAAAGCGGGAATGCGTTTCGAGGATCTTCGAGGATCTTCAGCTCGTCGGATTCACGTCGGATTCAGCATGGGCGCACATGCAAACATTTGCAGACCGGTCGCCTTGACCGCCGAGGATGCCGACTATGTTATGGATTTGATCGACCCGTGGGTCGCAACCAGGTTGCTTTTGGCATGAA

Full Affymetrix probeset data:

Annotations for 1625591_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720