Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625592_s_at:

>probe:Drosophila_2:1625592_s_at:589:723; Interrogation_Position=1036; Antisense; TTGCTGCAGATGGAAACTGGCCCCT
>probe:Drosophila_2:1625592_s_at:28:89; Interrogation_Position=1137; Antisense; AGTACTCAGCCCTCAATTTTGTCGA
>probe:Drosophila_2:1625592_s_at:499:245; Interrogation_Position=1151; Antisense; AATTTTGTCGACTTCTCCGGATGGA
>probe:Drosophila_2:1625592_s_at:587:629; Interrogation_Position=645; Antisense; TCCTATGCAGGCCATTTTCGAGCAT
>probe:Drosophila_2:1625592_s_at:539:693; Interrogation_Position=660; Antisense; TTTCGAGCATACACGAGGTCCCTTG
>probe:Drosophila_2:1625592_s_at:549:301; Interrogation_Position=691; Antisense; CCCGGCCAATTACTGTCCATGAAGA
>probe:Drosophila_2:1625592_s_at:20:465; Interrogation_Position=714; Antisense; GATTCCATTTCACCGGAACGTCAAG
>probe:Drosophila_2:1625592_s_at:152:487; Interrogation_Position=733; Antisense; GTCAAGTCGTCCTTAAGTTTTCCAT
>probe:Drosophila_2:1625592_s_at:43:15; Interrogation_Position=756; Antisense; ATTATTTCCCCTGAACGGTCAGCGT
>probe:Drosophila_2:1625592_s_at:36:535; Interrogation_Position=807; Antisense; GGTGATCGATGGCATCTCCACGGAT
>probe:Drosophila_2:1625592_s_at:666:385; Interrogation_Position=927; Antisense; GAACACTTTGAAAACCTCTTGCTAC
>probe:Drosophila_2:1625592_s_at:83:253; Interrogation_Position=951; Antisense; CAAGATGTCTAGCTCGGAACGATAT
>probe:Drosophila_2:1625592_s_at:548:381; Interrogation_Position=967; Antisense; GAACGATATACTTCCCACTCCGGTA
>probe:Drosophila_2:1625592_s_at:410:281; Interrogation_Position=984; Antisense; CTCCGGTATTCCCTCAAATCATTAT

Paste this into a BLAST search page for me
TTGCTGCAGATGGAAACTGGCCCCTAGTACTCAGCCCTCAATTTTGTCGAAATTTTGTCGACTTCTCCGGATGGATCCTATGCAGGCCATTTTCGAGCATTTTCGAGCATACACGAGGTCCCTTGCCCGGCCAATTACTGTCCATGAAGAGATTCCATTTCACCGGAACGTCAAGGTCAAGTCGTCCTTAAGTTTTCCATATTATTTCCCCTGAACGGTCAGCGTGGTGATCGATGGCATCTCCACGGATGAACACTTTGAAAACCTCTTGCTACCAAGATGTCTAGCTCGGAACGATATGAACGATATACTTCCCACTCCGGTACTCCGGTATTCCCTCAAATCATTAT

Full Affymetrix probeset data:

Annotations for 1625592_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime