Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625595_a_at:

>probe:Drosophila_2:1625595_a_at:172:421; Interrogation_Position=169; Antisense; GAGCACGATAACGTCTTCATCTTTG
>probe:Drosophila_2:1625595_a_at:468:197; Interrogation_Position=178; Antisense; AACGTCTTCATCTTTGTGCCAAATC
>probe:Drosophila_2:1625595_a_at:700:595; Interrogation_Position=192; Antisense; TGTGCCAAATCTGATCGGCTACGCC
>probe:Drosophila_2:1625595_a_at:444:285; Interrogation_Position=232; Antisense; CTGATCGCCTTCTGGTTCATGTCCA
>probe:Drosophila_2:1625595_a_at:486:541; Interrogation_Position=245; Antisense; GGTTCATGTCCACCAACTATGTGAT
>probe:Drosophila_2:1625595_a_at:463:253; Interrogation_Position=258; Antisense; CAACTATGTGATCTCCGGCTGGTGT
>probe:Drosophila_2:1625595_a_at:310:1; Interrogation_Position=273; Antisense; CGGCTGGTGTTATGTAACCTCCGCC
>probe:Drosophila_2:1625595_a_at:159:287; Interrogation_Position=301; Antisense; CTGGACGCCGTCGATGGACAAGCAG
>probe:Drosophila_2:1625595_a_at:29:159; Interrogation_Position=318; Antisense; ACAAGCAGCCCGAGCCTTTAACCAA
>probe:Drosophila_2:1625595_a_at:622:691; Interrogation_Position=627; Antisense; TTTGGCGCCATGCTAGACCAGTTGA
>probe:Drosophila_2:1625595_a_at:679:675; Interrogation_Position=640; Antisense; TAGACCAGTTGACCGATCGCTGCGG
>probe:Drosophila_2:1625595_a_at:399:713; Interrogation_Position=696; Antisense; TTCTATCCCCGGTACATGTTCTGGT
>probe:Drosophila_2:1625595_a_at:272:153; Interrogation_Position=709; Antisense; ACATGTTCTGGTTCCAGCTGTCCAT
>probe:Drosophila_2:1625595_a_at:177:141; Interrogation_Position=742; Antisense; ACGTGGCCTGTCACTGGCTCTTCAT

Paste this into a BLAST search page for me
GAGCACGATAACGTCTTCATCTTTGAACGTCTTCATCTTTGTGCCAAATCTGTGCCAAATCTGATCGGCTACGCCCTGATCGCCTTCTGGTTCATGTCCAGGTTCATGTCCACCAACTATGTGATCAACTATGTGATCTCCGGCTGGTGTCGGCTGGTGTTATGTAACCTCCGCCCTGGACGCCGTCGATGGACAAGCAGACAAGCAGCCCGAGCCTTTAACCAATTTGGCGCCATGCTAGACCAGTTGATAGACCAGTTGACCGATCGCTGCGGTTCTATCCCCGGTACATGTTCTGGTACATGTTCTGGTTCCAGCTGTCCATACGTGGCCTGTCACTGGCTCTTCAT

Full Affymetrix probeset data:

Annotations for 1625595_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime