FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625596_at:

>probe:Drosophila_2:1625596_at:19:581; Interrogation_Position=2700; Antisense; GGCCAAGGCGGCTCAGAACTTCGAA
>probe:Drosophila_2:1625596_at:230:385; Interrogation_Position=2715; Antisense; GAACTTCGAAGGCTGTCCGGACATA
>probe:Drosophila_2:1625596_at:57:675; Interrogation_Position=2790; Antisense; TACCACACATAGCAGCCTTAGCGAA
>probe:Drosophila_2:1625596_at:722:169; Interrogation_Position=2821; Antisense; AAAGTTTTCAGATATCCAGCCTCCA
>probe:Drosophila_2:1625596_at:88:527; Interrogation_Position=2868; Antisense; GGGACACGCTCCGACTGATTTCGGA
>probe:Drosophila_2:1625596_at:352:553; Interrogation_Position=2890; Antisense; GGAGCAGCACATACGCATATTGTAG
>probe:Drosophila_2:1625596_at:345:91; Interrogation_Position=2913; Antisense; AGTACCACACTTTGATCTAGAGCAT
>probe:Drosophila_2:1625596_at:36:661; Interrogation_Position=2978; Antisense; TAACCAAGTTTAATCCATACCCCTG
>probe:Drosophila_2:1625596_at:198:133; Interrogation_Position=2996; Antisense; ACCCCTGCGTCGAAATGTACTTTGA
>probe:Drosophila_2:1625596_at:147:603; Interrogation_Position=3018; Antisense; TGATTATTTCTTCCTGACTACCGGT
>probe:Drosophila_2:1625596_at:316:403; Interrogation_Position=3033; Antisense; GACTACCGGTTAACCATTTCTAGTG
>probe:Drosophila_2:1625596_at:727:443; Interrogation_Position=3082; Antisense; GATGATAGCTCTTAATCCTCGGTTT
>probe:Drosophila_2:1625596_at:632:677; Interrogation_Position=3120; Antisense; TAGATGTCTTTTTCCTTTCCGCTGA
>probe:Drosophila_2:1625596_at:95:369; Interrogation_Position=3143; Antisense; GAATGCATACTTCGCCTTTGTTGTG

Paste this into a BLAST search page for me
GGCCAAGGCGGCTCAGAACTTCGAAGAACTTCGAAGGCTGTCCGGACATATACCACACATAGCAGCCTTAGCGAAAAAGTTTTCAGATATCCAGCCTCCAGGGACACGCTCCGACTGATTTCGGAGGAGCAGCACATACGCATATTGTAGAGTACCACACTTTGATCTAGAGCATTAACCAAGTTTAATCCATACCCCTGACCCCTGCGTCGAAATGTACTTTGATGATTATTTCTTCCTGACTACCGGTGACTACCGGTTAACCATTTCTAGTGGATGATAGCTCTTAATCCTCGGTTTTAGATGTCTTTTTCCTTTCCGCTGAGAATGCATACTTCGCCTTTGTTGTG

Full Affymetrix probeset data:

Annotations for 1625596_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720