FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625598_at:

>probe:Drosophila_2:1625598_at:300:487; Interrogation_Position=1185; Antisense; GTACCTATTTGCCTTTGGAGCACCA
>probe:Drosophila_2:1625598_at:250:111; Interrogation_Position=1209; Antisense; AGCAACCGCATGGATTTGCCCCAGG
>probe:Drosophila_2:1625598_at:623:571; Interrogation_Position=1234; Antisense; GGCTCAAGAGCTATGTTGCCGGCTG
>probe:Drosophila_2:1625598_at:179:555; Interrogation_Position=1260; Antisense; GGACCTGATGAGACCGGCACCGGCA
>probe:Drosophila_2:1625598_at:560:565; Interrogation_Position=1275; Antisense; GGCACCGGCAACACTGAAGTATCCA
>probe:Drosophila_2:1625598_at:542:25; Interrogation_Position=1317; Antisense; ATAGTCAGCGAAGCGAACTGCGCCC
>probe:Drosophila_2:1625598_at:665:551; Interrogation_Position=1343; Antisense; GGAGCTGCCACATGTTCTGGTCCAG
>probe:Drosophila_2:1625598_at:166:419; Interrogation_Position=1370; Antisense; GAGCTCCCTGTGTGCCAAGAAAACG
>probe:Drosophila_2:1625598_at:99:521; Interrogation_Position=1423; Antisense; GTGGACCATTGATGCTGCGGGAACA
>probe:Drosophila_2:1625598_at:675:37; Interrogation_Position=1473; Antisense; ATCTCCGGAGGTGTGATCAACGAAA
>probe:Drosophila_2:1625598_at:170:597; Interrogation_Position=1509; Antisense; TGTGAGCTATCCAAGCCATCCGTAT
>probe:Drosophila_2:1625598_at:446:45; Interrogation_Position=1526; Antisense; ATCCGTATTCACTGATGTGGCCAAG
>probe:Drosophila_2:1625598_at:209:373; Interrogation_Position=1670; Antisense; GAAGATCCATGTATTACTGCCTACT
>probe:Drosophila_2:1625598_at:427:181; Interrogation_Position=1748; Antisense; AAAACGGCGCATCTTGAATACACTG

Paste this into a BLAST search page for me
GTACCTATTTGCCTTTGGAGCACCAAGCAACCGCATGGATTTGCCCCAGGGGCTCAAGAGCTATGTTGCCGGCTGGGACCTGATGAGACCGGCACCGGCAGGCACCGGCAACACTGAAGTATCCAATAGTCAGCGAAGCGAACTGCGCCCGGAGCTGCCACATGTTCTGGTCCAGGAGCTCCCTGTGTGCCAAGAAAACGGTGGACCATTGATGCTGCGGGAACAATCTCCGGAGGTGTGATCAACGAAATGTGAGCTATCCAAGCCATCCGTATATCCGTATTCACTGATGTGGCCAAGGAAGATCCATGTATTACTGCCTACTAAAACGGCGCATCTTGAATACACTG

Full Affymetrix probeset data:

Annotations for 1625598_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720