FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625599_at:

>probe:Drosophila_2:1625599_at:284:429; Interrogation_Position=1001; Antisense; GAGTTCTTCTACGACCAACTAAAGC
>probe:Drosophila_2:1625599_at:362:663; Interrogation_Position=1020; Antisense; TAAAGCCCTGGGTGCACTATGTGCC
>probe:Drosophila_2:1625599_at:50:103; Interrogation_Position=1050; Antisense; AGAGCTACCCCAGTCAGCAGGAGTA
>probe:Drosophila_2:1625599_at:16:91; Interrogation_Position=1071; Antisense; AGTACGAGCACATCTTGTCCTTTTT
>probe:Drosophila_2:1625599_at:574:449; Interrogation_Position=1123; Antisense; GATCGCTCAGCGTGGATACGACTTC
>probe:Drosophila_2:1625599_at:338:403; Interrogation_Position=1142; Antisense; GACTTCATCTGGGAGCATTTGCGCA
>probe:Drosophila_2:1625599_at:518:509; Interrogation_Position=1180; Antisense; GTGCTATTGGCGCAAGCTGCTCAAG
>probe:Drosophila_2:1625599_at:305:377; Interrogation_Position=1213; Antisense; GAAGCTGCTGCAATACGAGGTTAAG
>probe:Drosophila_2:1625599_at:267:125; Interrogation_Position=1236; Antisense; AGCCGGAGGATCAACTTATTTACAT
>probe:Drosophila_2:1625599_at:549:677; Interrogation_Position=1338; Antisense; TAGAGCAGCGTGAATCTCTCTGTCC
>probe:Drosophila_2:1625599_at:676:285; Interrogation_Position=1357; Antisense; CTGTCCGCATTCCATGCATTTTTGA
>probe:Drosophila_2:1625599_at:646:581; Interrogation_Position=927; Antisense; TGGCCGCCAGTTTTCGTCTGAAGCA
>probe:Drosophila_2:1625599_at:667:499; Interrogation_Position=942; Antisense; GTCTGAAGCACTTGTTCCTCTGCAA
>probe:Drosophila_2:1625599_at:618:219; Interrogation_Position=965; Antisense; AAGTCGCTGGTCTTCCATGTGGGCG

Paste this into a BLAST search page for me
GAGTTCTTCTACGACCAACTAAAGCTAAAGCCCTGGGTGCACTATGTGCCAGAGCTACCCCAGTCAGCAGGAGTAAGTACGAGCACATCTTGTCCTTTTTGATCGCTCAGCGTGGATACGACTTCGACTTCATCTGGGAGCATTTGCGCAGTGCTATTGGCGCAAGCTGCTCAAGGAAGCTGCTGCAATACGAGGTTAAGAGCCGGAGGATCAACTTATTTACATTAGAGCAGCGTGAATCTCTCTGTCCCTGTCCGCATTCCATGCATTTTTGATGGCCGCCAGTTTTCGTCTGAAGCAGTCTGAAGCACTTGTTCCTCTGCAAAAGTCGCTGGTCTTCCATGTGGGCG

Full Affymetrix probeset data:

Annotations for 1625599_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720