Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625601_at:

>probe:Drosophila_2:1625601_at:184:239; Interrogation_Position=1276; Antisense; AATCTTGGTGCCGATGGCTACTCCA
>probe:Drosophila_2:1625601_at:648:629; Interrogation_Position=1297; Antisense; TCCAGTGGACGTCCCGGCAATGGAA
>probe:Drosophila_2:1625601_at:95:307; Interrogation_Position=1357; Antisense; CCAGGAGGCCAGGATTTGGGACCTA
>probe:Drosophila_2:1625601_at:482:273; Interrogation_Position=1379; Antisense; CTAGTGGATATTCCGGTGGTCGTCC
>probe:Drosophila_2:1625601_at:416:591; Interrogation_Position=1395; Antisense; TGGTCGTCCAGGAGGTCAGGATCTA
>probe:Drosophila_2:1625601_at:708:531; Interrogation_Position=1426; Antisense; GGTGGCTACTCCAATGGCAAGCCGG
>probe:Drosophila_2:1625601_at:156:253; Interrogation_Position=1456; Antisense; CAAGACTTGGGACCAGGCGGTTACT
>probe:Drosophila_2:1625601_at:93:75; Interrogation_Position=1502; Antisense; AGGACTTGGGTCGAGACGGCTACTC
>probe:Drosophila_2:1625601_at:298:145; Interrogation_Position=1568; Antisense; ACTCCAATGGTAGGCCAGGCGGCAA
>probe:Drosophila_2:1625601_at:403:47; Interrogation_Position=1605; Antisense; ATCCGATGGCGGTCGTGTGATCATC
>probe:Drosophila_2:1625601_at:431:137; Interrogation_Position=1683; Antisense; ACGTCCCGGTGGTCAGGATCTTGGA
>probe:Drosophila_2:1625601_at:430:543; Interrogation_Position=1698; Antisense; GGATCTTGGACGTGATGGCTACTCC
>probe:Drosophila_2:1625601_at:50:289; Interrogation_Position=1749; Antisense; CGGCAACGGCCAGGATAGTCAGGAT
>probe:Drosophila_2:1625601_at:38:139; Interrogation_Position=1850; Antisense; ACGATGGCAGCGGTTATCGGTACTA

Paste this into a BLAST search page for me
AATCTTGGTGCCGATGGCTACTCCATCCAGTGGACGTCCCGGCAATGGAACCAGGAGGCCAGGATTTGGGACCTACTAGTGGATATTCCGGTGGTCGTCCTGGTCGTCCAGGAGGTCAGGATCTAGGTGGCTACTCCAATGGCAAGCCGGCAAGACTTGGGACCAGGCGGTTACTAGGACTTGGGTCGAGACGGCTACTCACTCCAATGGTAGGCCAGGCGGCAAATCCGATGGCGGTCGTGTGATCATCACGTCCCGGTGGTCAGGATCTTGGAGGATCTTGGACGTGATGGCTACTCCCGGCAACGGCCAGGATAGTCAGGATACGATGGCAGCGGTTATCGGTACTA

Full Affymetrix probeset data:

Annotations for 1625601_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime