Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625603_at:

>probe:Drosophila_2:1625603_at:539:491; Interrogation_Position=2487; Antisense; GTAAATTTTTTGTTCGCTTAGCTAT
>probe:Drosophila_2:1625603_at:581:667; Interrogation_Position=2530; Antisense; TACTGTTTAGAAATTGGCGCCGCAT
>probe:Drosophila_2:1625603_at:105:583; Interrogation_Position=2544; Antisense; TGGCGCCGCATTAAGTTGATTGTAC
>probe:Drosophila_2:1625603_at:265:445; Interrogation_Position=2608; Antisense; GATGCAAACCGATGGAATGCGATTT
>probe:Drosophila_2:1625603_at:721:49; Interrogation_Position=2624; Antisense; ATGCGATTTTGCTGCGGTGTATAAA
>probe:Drosophila_2:1625603_at:458:689; Interrogation_Position=2676; Antisense; TATTGAGAAGCCAGCGCGACGGACT
>probe:Drosophila_2:1625603_at:257:325; Interrogation_Position=2691; Antisense; GCGACGGACTCATACTTTATTGCAA
>probe:Drosophila_2:1625603_at:361:247; Interrogation_Position=2782; Antisense; AATTGAGCGCTAGCTCGCCGCTTTA
>probe:Drosophila_2:1625603_at:637:673; Interrogation_Position=2805; Antisense; TAGCCATAGACTAACTTGCCCTGTT
>probe:Drosophila_2:1625603_at:65:149; Interrogation_Position=2818; Antisense; ACTTGCCCTGTTACTAGCTTAGTTG
>probe:Drosophila_2:1625603_at:386:721; Interrogation_Position=2852; Antisense; TTGATTAGCCTTGCTGCGTAACGCA
>probe:Drosophila_2:1625603_at:717:327; Interrogation_Position=2867; Antisense; GCGTAACGCAGTTTTTTGTAGCCAT
>probe:Drosophila_2:1625603_at:313:439; Interrogation_Position=2900; Antisense; GAGGCAGACTTTTCTTAGCAACTTG
>probe:Drosophila_2:1625603_at:265:609; Interrogation_Position=2926; Antisense; TGAGACTACTCCGTACGTAAAGCCC

Paste this into a BLAST search page for me
GTAAATTTTTTGTTCGCTTAGCTATTACTGTTTAGAAATTGGCGCCGCATTGGCGCCGCATTAAGTTGATTGTACGATGCAAACCGATGGAATGCGATTTATGCGATTTTGCTGCGGTGTATAAATATTGAGAAGCCAGCGCGACGGACTGCGACGGACTCATACTTTATTGCAAAATTGAGCGCTAGCTCGCCGCTTTATAGCCATAGACTAACTTGCCCTGTTACTTGCCCTGTTACTAGCTTAGTTGTTGATTAGCCTTGCTGCGTAACGCAGCGTAACGCAGTTTTTTGTAGCCATGAGGCAGACTTTTCTTAGCAACTTGTGAGACTACTCCGTACGTAAAGCCC

Full Affymetrix probeset data:

Annotations for 1625603_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime