FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625604_at:

>probe:Drosophila_2:1625604_at:224:265; Interrogation_Position=301; Antisense; CAGGATAACAACGAGGTGGCCACCA
>probe:Drosophila_2:1625604_at:342:415; Interrogation_Position=329; Antisense; GAGCCAATCTGACTGACCTGGTGGT
>probe:Drosophila_2:1625604_at:118:513; Interrogation_Position=349; Antisense; GTGGTCAAGGGTTTTGCCAACACAA
>probe:Drosophila_2:1625604_at:458:105; Interrogation_Position=398; Antisense; AGAAAGACTTTAGCTGGCAGACCAA
>probe:Drosophila_2:1625604_at:140:555; Interrogation_Position=469; Antisense; GGACGAATACTCCTTATACCACTGA
>probe:Drosophila_2:1625604_at:394:443; Interrogation_Position=523; Antisense; GATGATCTTGACATTTTGCTACTAA
>probe:Drosophila_2:1625604_at:682:221; Interrogation_Position=568; Antisense; AAGGGTGGCTTCACCTTCGACAACG
>probe:Drosophila_2:1625604_at:40:513; Interrogation_Position=592; Antisense; GTGACCGCTGTGCAGGTTCAACTGA
>probe:Drosophila_2:1625604_at:620:283; Interrogation_Position=613; Antisense; CTGAATCTGTCCAAAGTGCGCACTT
>probe:Drosophila_2:1625604_at:185:507; Interrogation_Position=628; Antisense; GTGCGCACTTATCTGGACAATCTAT
>probe:Drosophila_2:1625604_at:139:329; Interrogation_Position=711; Antisense; GCGGGATTTCTACGAGGCCCTGAAA
>probe:Drosophila_2:1625604_at:592:321; Interrogation_Position=727; Antisense; GCCCTGAAACCACTCATCGTTGAGA
>probe:Drosophila_2:1625604_at:351:27; Interrogation_Position=799; Antisense; ATACCAGCCAACTTTTTCGTTGAGG
>probe:Drosophila_2:1625604_at:178:321; Interrogation_Position=834; Antisense; GCCCCAGCAACTTTATGGTCCAAAG

Paste this into a BLAST search page for me
CAGGATAACAACGAGGTGGCCACCAGAGCCAATCTGACTGACCTGGTGGTGTGGTCAAGGGTTTTGCCAACACAAAGAAAGACTTTAGCTGGCAGACCAAGGACGAATACTCCTTATACCACTGAGATGATCTTGACATTTTGCTACTAAAAGGGTGGCTTCACCTTCGACAACGGTGACCGCTGTGCAGGTTCAACTGACTGAATCTGTCCAAAGTGCGCACTTGTGCGCACTTATCTGGACAATCTATGCGGGATTTCTACGAGGCCCTGAAAGCCCTGAAACCACTCATCGTTGAGAATACCAGCCAACTTTTTCGTTGAGGGCCCCAGCAACTTTATGGTCCAAAG

Full Affymetrix probeset data:

Annotations for 1625604_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720