FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625605_at:

>probe:Drosophila_2:1625605_at:374:57; Interrogation_Position=449; Antisense; ATGAGCAGCACATCTCGATTCCGAG
>probe:Drosophila_2:1625605_at:642:551; Interrogation_Position=474; Antisense; GGAGCCGAGTTTTCACGTCAAGTTC
>probe:Drosophila_2:1625605_at:302:455; Interrogation_Position=507; Antisense; GATAACCGGAGCTCTGGACAACATA
>probe:Drosophila_2:1625605_at:328:29; Interrogation_Position=529; Antisense; ATACGGGCGCATAGTTCGGCCAAAC
>probe:Drosophila_2:1625605_at:211:187; Interrogation_Position=551; Antisense; AACACATTGACTATGGCTGCCAGTT
>probe:Drosophila_2:1625605_at:253:171; Interrogation_Position=593; Antisense; AAAGATGCCGTGAAGTTTCGCCCAA
>probe:Drosophila_2:1625605_at:6:439; Interrogation_Position=619; Antisense; GAGGCTCTGAATCACGTATTTGGAT
>probe:Drosophila_2:1625605_at:95:575; Interrogation_Position=691; Antisense; GGCGGTCACTCAATGGATACTTTCC
>probe:Drosophila_2:1625605_at:105:269; Interrogation_Position=741; Antisense; CAGGTGCCATGTGCCAGACTTAAAC
>probe:Drosophila_2:1625605_at:391:709; Interrogation_Position=832; Antisense; TTCAAGATCGACTTCCTTATTCACC
>probe:Drosophila_2:1625605_at:593:11; Interrogation_Position=850; Antisense; ATTCACCGCCTATCCCAATATTTAA
>probe:Drosophila_2:1625605_at:67:243; Interrogation_Position=866; Antisense; AATATTTAACTCTCTGTCCGGGCGA
>probe:Drosophila_2:1625605_at:54:311; Interrogation_Position=913; Antisense; GCCGGATCGGGTGCATTTCGTCATC
>probe:Drosophila_2:1625605_at:262:639; Interrogation_Position=930; Antisense; TCGTCATCCGTCGTGCTTTTTGAAG

Paste this into a BLAST search page for me
ATGAGCAGCACATCTCGATTCCGAGGGAGCCGAGTTTTCACGTCAAGTTCGATAACCGGAGCTCTGGACAACATAATACGGGCGCATAGTTCGGCCAAACAACACATTGACTATGGCTGCCAGTTAAAGATGCCGTGAAGTTTCGCCCAAGAGGCTCTGAATCACGTATTTGGATGGCGGTCACTCAATGGATACTTTCCCAGGTGCCATGTGCCAGACTTAAACTTCAAGATCGACTTCCTTATTCACCATTCACCGCCTATCCCAATATTTAAAATATTTAACTCTCTGTCCGGGCGAGCCGGATCGGGTGCATTTCGTCATCTCGTCATCCGTCGTGCTTTTTGAAG

Full Affymetrix probeset data:

Annotations for 1625605_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720