FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625606_at:

>probe:Drosophila_2:1625606_at:377:27; Interrogation_Position=305; Antisense; ATAGCGCCTCTAATCTTAGTGACAG
>probe:Drosophila_2:1625606_at:721:33; Interrogation_Position=331; Antisense; ATCACACAGCATCCGAACGTCGAAG
>probe:Drosophila_2:1625606_at:478:9; Interrogation_Position=412; Antisense; ATTCATCTAATGTCGGCCATCAGCA
>probe:Drosophila_2:1625606_at:275:299; Interrogation_Position=482; Antisense; CGCGTCGCCTGAAGAATCTGCTGAA
>probe:Drosophila_2:1625606_at:675:335; Interrogation_Position=510; Antisense; GCTGCTCGGTCAATTCTTCAACATG
>probe:Drosophila_2:1625606_at:686:433; Interrogation_Position=595; Antisense; GAGTGGCTCAGCAACGATATGGACA
>probe:Drosophila_2:1625606_at:366:587; Interrogation_Position=638; Antisense; TGGAGCATCGCCTCATCGAGGAAAT
>probe:Drosophila_2:1625606_at:171:395; Interrogation_Position=658; Antisense; GAAATCCGCCAGTGCGCCAAGGAAG
>probe:Drosophila_2:1625606_at:341:373; Interrogation_Position=679; Antisense; GAAGATGCCGTCATCGTTTACAATG
>probe:Drosophila_2:1625606_at:457:615; Interrogation_Position=722; Antisense; TGCACACCATCGACCAGGAGGATTA
>probe:Drosophila_2:1625606_at:28:683; Interrogation_Position=748; Antisense; TATGTACCAGTGCATTTTGCCCGCA
>probe:Drosophila_2:1625606_at:338:715; Interrogation_Position=790; Antisense; TTCTGGACATCGGTGCAACCCAAAG
>probe:Drosophila_2:1625606_at:150:619; Interrogation_Position=817; Antisense; TGCGAACCCTATGCCATCGAATGGA
>probe:Drosophila_2:1625606_at:284:385; Interrogation_Position=840; Antisense; GAACTTCCTGGACCGTTGGGCTCAA

Paste this into a BLAST search page for me
ATAGCGCCTCTAATCTTAGTGACAGATCACACAGCATCCGAACGTCGAAGATTCATCTAATGTCGGCCATCAGCACGCGTCGCCTGAAGAATCTGCTGAAGCTGCTCGGTCAATTCTTCAACATGGAGTGGCTCAGCAACGATATGGACATGGAGCATCGCCTCATCGAGGAAATGAAATCCGCCAGTGCGCCAAGGAAGGAAGATGCCGTCATCGTTTACAATGTGCACACCATCGACCAGGAGGATTATATGTACCAGTGCATTTTGCCCGCATTCTGGACATCGGTGCAACCCAAAGTGCGAACCCTATGCCATCGAATGGAGAACTTCCTGGACCGTTGGGCTCAA

Full Affymetrix probeset data:

Annotations for 1625606_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720